View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_high_40 (Length: 273)
Name: NF3021_high_40
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_high_40 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 5e-99; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 18 - 273
Target Start/End: Complemental strand, 3197066 - 3196820
Alignment:
| Q |
18 |
gtgaaggtaacaaaagttgcctaaagtgacctatgaaggaacttttacttagaattattgaagcaaaggactgagaattttctgtctagtttttagacct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
3197066 |
gtgaaggtaacaaaagttgcctaaagtgacctatgaaggaacttttacttagaattattgaagcaaaggactgagaattttctgtctagttttcat--ct |
3196969 |
T |
|
| Q |
118 |
ggtgcaaaactctctttgcatctaatacaaactgctttttattgttaaaaatacttggtaattaaactaaatgatgtatatgattttatttttgttgcat |
217 |
Q |
| |
|
| |||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3196968 |
aatacaaac-------tgcttttaatacaaactgctttttattgttaaaaatacttggtaattaaactaaatgctgtatatgattttatttttgttgcat |
3196876 |
T |
|
| Q |
218 |
ataaatattttatactttgttaagatacatatgtttgcttttcattgtttgtttca |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3196875 |
ataaatattttatactttgttaagatacatatgtttgcttttcattgtttgtttca |
3196820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 233 - 273
Target Start/End: Complemental strand, 3196556 - 3196516
Alignment:
| Q |
233 |
tttgttaagatacatatgtttgcttttcattgtttgtttca |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3196556 |
tttgttaagatacatatgtttgcttttcattgtttgtttca |
3196516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 233 - 273
Target Start/End: Complemental strand, 3196708 - 3196668
Alignment:
| Q |
233 |
tttgttaagatacatatgtttgcttttcattgtttgtttca |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3196708 |
tttgttaagatacatatgtttgcttttcattgtttgtttca |
3196668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University