View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3021_high_56 (Length: 238)

Name: NF3021_high_56
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3021_high_56
NF3021_high_56
[»] chr8 (1 HSPs)
chr8 (1-175)||(9516178-9516352)


Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 9516352 - 9516178
Alignment:
1 tgatcggaatctagagttaaaacgatgtcgttttgattatttccggtaatgagattggtgaagtcggaatcttcaagagaaggaagagaatgtaaataaa 100  Q
    ||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9516352 tgatctgagtctagggttaaaacgatgtcgttttgattatttccggtaatgagattggtgaagtcggaatcttcaagagaaggaagagaatgtaaataaa 9516253  T
101 gcgaaactttacgatagaacatgttcggttgcatggtttggtttagttcggggactttgaggtattggtaaagat 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9516252 gcgaaactttacgatagaacatgttcggttgcatggtttggtttagttcggggactttgaggtattggtaaagat 9516178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University