View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3021_high_62 (Length: 233)

Name: NF3021_high_62
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3021_high_62
NF3021_high_62
[»] chr2 (1 HSPs)
chr2 (18-221)||(13050652-13050857)


Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 13050857 - 13050652
Alignment:
18 gttgaagcgctgtatggtcttagta-atgggatcgtttgcaagcatcggtaaacgttttgaaaatgcttactgagtagaactctgcaggttgcaacaaga 116  Q
    ||||||||||| ||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||| |||| ||||    
13050857 gttgaagcgctatatggtcttagcatatgggatcgtttgcaagcattggtaaacgttttgaaaatgcttactgagcagaactctacaggtggcaataaga 13050758  T
117 aggagaaatgactaatcacgttagggcggttaatgtgccaactggttaatagtcacattcgaataatatggggcttct-gtttgtctccaactactacct 215  Q
    |||||||||||||||||| ||||||  |||| ||||| |||||||||||| ||||||||| ||||||| ||||||||| |||||||||||||| ||||||    
13050757 aggagaaatgactaatcatgttaggttggttgatgtgacaactggttaattgtcacattcaaataatacggggcttctggtttgtctccaactgctacct 13050658  T
216 atgcta 221  Q
     |||||    
13050657 gtgcta 13050652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University