View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_high_67 (Length: 227)
Name: NF3021_high_67
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_high_67 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 9516556 - 9516330
Alignment:
| Q |
1 |
gtgatattaacgaacaaacgtagatcacgtttgccgttgtattctatttcagcggacatggttgtgatatgatgaagataactgctgagtattcttcttt |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||| || | |||||||| || |
|
|
| T |
9516556 |
gtgatattaacgaacaaacgtaaatcacgttttccgttgtattctatttcagcggacatggtggtaatatgatgaagataactacttaatattcttcgtt |
9516457 |
T |
 |
| Q |
101 |
tatcggtttttctgattttgagaacaaatgcaccggtttgatttggttcggnnnnnnnatagaaccaataaacagtggcaccgaggaacctgtcttcgat |
200 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
9516456 |
tatcggtttttctgatcttgatcacaaatgcaccggtttgatttggttcggtttttgtatagaaccaataaaccgtagcaccgagaaacctgtcttcgat |
9516357 |
T |
 |
| Q |
201 |
gatttgatcggaatctagagttaaaac |
227 |
Q |
| |
|
||||||||| || ||||| |||||||| |
|
|
| T |
9516356 |
gatttgatctgagtctagggttaaaac |
9516330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University