View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3021_high_67 (Length: 227)

Name: NF3021_high_67
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3021_high_67
NF3021_high_67
[»] chr8 (1 HSPs)
chr8 (1-227)||(9516330-9516556)


Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 9516556 - 9516330
Alignment:
1 gtgatattaacgaacaaacgtagatcacgtttgccgttgtattctatttcagcggacatggttgtgatatgatgaagataactgctgagtattcttcttt 100  Q
    |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||| || | |||||||| ||    
9516556 gtgatattaacgaacaaacgtaaatcacgttttccgttgtattctatttcagcggacatggtggtaatatgatgaagataactacttaatattcttcgtt 9516457  T
101 tatcggtttttctgattttgagaacaaatgcaccggtttgatttggttcggnnnnnnnatagaaccaataaacagtggcaccgaggaacctgtcttcgat 200  Q
    |||||||||||||||| ||||  ||||||||||||||||||||||||||||       ||||||||||||||| || |||||||| ||||||||||||||    
9516456 tatcggtttttctgatcttgatcacaaatgcaccggtttgatttggttcggtttttgtatagaaccaataaaccgtagcaccgagaaacctgtcttcgat 9516357  T
201 gatttgatcggaatctagagttaaaac 227  Q
    ||||||||| || ||||| ||||||||    
9516356 gatttgatctgagtctagggttaaaac 9516330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University