View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_high_68 (Length: 226)
Name: NF3021_high_68
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_high_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 14 - 192
Target Start/End: Original strand, 506267 - 506445
Alignment:
| Q |
14 |
attatactaaaggtgttattaggtttggacaacagtttgttgtatcaatcaactgccatatacttttcatatcagattcagaactctgatccctatgaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
506267 |
attatactaaaggtgttattaggtttggagaacagtttgttgtatcaatcaactgccatatacttttcatatcagattcagaactctgatccctctgaaa |
506366 |
T |
|
| Q |
114 |
gagtcttcttttaagtggggtttttgtagaggtttaagtgattctgggaccattacaagactctcagacaagtgatgtt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
506367 |
gagtcttcttttaagtggggtttttgtagaggtttaagtgattctgggaccattacaagactctcagacaagtgatgtt |
506445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University