View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_high_69 (Length: 224)
Name: NF3021_high_69
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_high_69 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0050 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 17532 - 17342
Alignment:
| Q |
19 |
gttagggtcatagagggttaaatccatctgcaacatgataattaaagctacaactctcaatattcttatatttcaaccagaaa-gcatgaatattaaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17532 |
gttagggtcatagagggttaaatccatctgcaacatgataattaaagcagcaactctcaatattcttatatttcaaccagaaaagcatgaatattaaaaa |
17433 |
T |
 |
| Q |
118 |
agtttagttgcttggaacatgctgtgcagcctacacaattcacccaaagaatgtcacttcctgtgtcaacttgtgacgtgtgcctctctgt |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
17432 |
agtttagttgcttgggacatgctgtgcagcctacacaattcacccaaagaatgtcacttcttttgtcaacttgtgacgtgtgcctctctgt |
17342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 19 - 126
Target Start/End: Original strand, 30500732 - 30500839
Alignment:
| Q |
19 |
gttagggtcatagagggttaaatccatctgcaacatgataattaaagctacaactctcaatattcttatatttcaaccagaaagcatgaatattaaaaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30500732 |
gttagggtcatagagggttaaatccatctgcaacatgataattaaagcagcaactctcaatattcttatatttcaaccagaaagcatgaatattaaaaaa |
30500831 |
T |
 |
| Q |
119 |
gtttagtt |
126 |
Q |
| |
|
|||||||| |
|
|
| T |
30500832 |
gtttagtt |
30500839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 191
Target Start/End: Original strand, 30500866 - 30500929
Alignment:
| Q |
128 |
cttggaacatgctgtgcagcctacacaattcacccaaagaatgtcacttcctgtgtcaacttgt |
191 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30500866 |
cttgggacatgctgtgcagcctgcacaattcacccaaagaatgtcacttcctgtgtcaacttgt |
30500929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 190
Target Start/End: Complemental strand, 35017978 - 35017938
Alignment:
| Q |
150 |
acacaattcacccaaagaatgtcacttcctgtgtcaacttg |
190 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
35017978 |
acacaattcacccacagaatatcacttcctgtatcaacttg |
35017938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University