View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_high_74 (Length: 204)
Name: NF3021_high_74
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_high_74 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 115540 - 115709
Alignment:
| Q |
19 |
atgatgtgttgatgtgaaatgtttcctgcattagccaaatgtgataagttgcggggaaaggagatgattaagataagaccctaaaattaaaatgatgctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
115540 |
atgatgtgttgatgtgaaatgtttcctgcattagccaaatgtgataagttgcggggaaaggagatgattaagataagaccctaaaattaaaatgatgctg |
115639 |
T |
 |
| Q |
119 |
cgtacgtattctaagttgattttttcaaagaacgacactctacgtctctattttctaaatccgagtctgtg |
189 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
115640 |
cgtacgtattctaaattga-tttttcaaagaacgacactctacgtctctattttctaaatccgagtctgtg |
115709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University