View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_low_23 (Length: 422)
Name: NF3021_low_23
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 6e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 227 - 417
Target Start/End: Original strand, 30550706 - 30550896
Alignment:
| Q |
227 |
tattacttatctgataatagatt----gctgttacaagtttacaacataaatgcaatcatatatagacattgcttaaagatcaagttttatatattgata |
322 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30550706 |
tattacttatctgataatagattaattgctgttacatgtttacaacataaatgcaatcatatatagacattgcttaaagatcaagttttatatattgata |
30550805 |
T |
|
| Q |
323 |
aaaacattaattacaagtggaatttaattttgatcactagtatcatcatcttcttcttcagctattgaaacaatttcccctatgcctatgctact |
417 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30550806 |
aaaacatta----caagtggaatttaattttgatcactagtatcatcatcttcttcttcagctattgaaacaatttcccctatgcctctgctact |
30550896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University