View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_low_40 (Length: 300)
Name: NF3021_low_40
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 10 - 284
Target Start/End: Original strand, 42754431 - 42754705
Alignment:
| Q |
10 |
gcagagacagttgagaaatagcagtagtacccaagtgagtgtgcggatttgatggcagagacgatgtttggactgaggaaagcagttttaaggcagtttg |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42754431 |
gcagagaaagttgagaaatagcagtagtacccaagtgagtgtgcggatttgatggcagagacgatgtttggactgaggaaagcagttttaaggcagtttg |
42754530 |
T |
 |
| Q |
110 |
caattttgtcggtggtaatccctttggagtgaagctcttccatcatcctgtccatgagagaggtccacgatggcatggtggcgcggagttggttgaaaag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42754531 |
caattttgtcggtggtaatccctttggagtgaagctcttccatcatcctgtccatgagagaggtccacgatggcatggtggcgcggagttgattgaaaag |
42754630 |
T |
 |
| Q |
210 |
atcagagagacccatttggttgatcacccatctatcactgtcgtcgtcgataatggtacgatcaaagtccaaaac |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42754631 |
atcagagagacccatttggttgatcacccatctgtcactgtcgtcgtcgataatggtacgatcaaagtccaaaac |
42754705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University