View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_low_44 (Length: 293)
Name: NF3021_low_44
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 59 - 280
Target Start/End: Original strand, 3446876 - 3447097
Alignment:
| Q |
59 |
atttgaatttagttgaataatctgtatgttgtttaggacaattaactattcttcttaacatacatctacaaaacagtgaaagaaaataaaccacgggagg |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3446876 |
atttgaatttagttgaataatctgtatgttgtttaggacaattaactattcttcttaacatacatctacaaaacagtgaaagaaaataaaccacgggagg |
3446975 |
T |
 |
| Q |
159 |
attatgacatcttacacatcaatcaagccaggcatgacaacagcatctccataatcaatcacttgatgcacagaattatccttcttgccatatccttcaa |
258 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3446976 |
attttgacatcttacacatcaatcaagccaggcatgacaacagcatctccataatcaatcacttgatgcacagaattatccttcttgccataaccttcaa |
3447075 |
T |
 |
| Q |
259 |
caatagaaactatcttcccttc |
280 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3447076 |
caatagaaactatcttcccttc |
3447097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University