View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3021_low_46 (Length: 289)

Name: NF3021_low_46
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3021_low_46
NF3021_low_46
[»] chr2 (1 HSPs)
chr2 (108-153)||(42530652-42530697)


Alignment Details
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 42530697 - 42530652
Alignment:
108 aaacattgtgtaaagtttgggaaagatacaagtctatgttgagaaa 153  Q
    ||||||||| | |||  |||||||||||||||||||||||||||||    
42530697 aaacattgtatgaagcgtgggaaagatacaagtctatgttgagaaa 42530652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University