View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_low_50 (Length: 265)
Name: NF3021_low_50
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 47198050 - 47197791
Alignment:
| Q |
1 |
ttgtgggacttaacgagatccttgaagggactcttaacctcattagccactttactagctctgagtatgtcttcaaactcgggctcaatattttcaacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47198050 |
ttgtgggacttaacgagatccttgaagggactcttaacctcattagccactttactagctctgagtatgtcttcaaactcgggctcaatattttcaacac |
47197951 |
T |
|
| Q |
101 |
cacgaatctttcttagaacggctttccctttctcctcgaaacccctttcaatgagactgttgggagtatcatccactatgagagaccccattgtaagcat |
200 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47197950 |
cacgaatctttgtaagaacggctttccctttctcctcgaaacccctttcaatgagactgttgggagtatcatccactatgagagaccccattgtaagcat |
47197851 |
T |
|
| Q |
201 |
aactgctggaatgattgctccagccaatgataatctccacccatatccacctttgcttct |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
47197850 |
aactgctggaatgattgctccagccaatgatactctccacccatatccacctttgattct |
47197791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 47185168 - 47184916
Alignment:
| Q |
1 |
ttgtgggacttaacgagatccttgaagggactcttaacctcattagccactttactagctctgagtatgtcttcaaactcgggctcaatattttcaacac |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47185168 |
ttgtgggacttaacaagatccttgaaggggctcttgacctcattagccactttactagctctgagtatgtcttcaaactcgggctcaatattttcaacac |
47185069 |
T |
|
| Q |
101 |
cacgaatctttcttagaacggctttccctttctcctcgaaacccctttcaatgagactgttgggagtatcatccactatgagagaccccattgtaagcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47185068 |
cacgaatctttcttagaacggctttccctttctcctcgaaacccctttcaatgagactgttgggagtatcatccactatgagagaccccactgtaagcat |
47184969 |
T |
|
| Q |
201 |
aactgctggaatgattgctccagccaatgataatctccacccatatccacctt |
253 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
47184968 |
aactgctggaatgattgctccggccaatgatattctccacccatatccacctt |
47184916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University