View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_low_53 (Length: 251)
Name: NF3021_low_53
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_low_53 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 6 - 251
Target Start/End: Original strand, 13110678 - 13110927
Alignment:
| Q |
6 |
aggagcacagacaaaccagaactttcattcaaaaaatttaatgtgaaattaattctcaaattcaagaatataagaataaatgagaatatgtctaaatgta |
105 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13110678 |
aggatcacaaacaaaccagaactttcattcaaaatatttaatgtgaaattaattctcaaattcaagaatataagaataaatgagaatatgtctaaatgta |
13110777 |
T |
|
| Q |
106 |
aataattgag-----ttttctaaatgagaatatgtctactatgtaaataattcaccattgtttatcaattaaaatgattctttatgaacttttttagttg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13110778 |
aataattgagtttttttttctaaatgagaatatgtctactatgtaaataattcaccattgtttatcaattaaaatgattctttatgaacttttttagttg |
13110877 |
T |
|
| Q |
201 |
ttgctagtgtgtgcgtgnnnnnnncttccaacttttgcattaaccgacctt |
251 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
13110878 |
ttgctagcgtgtgcgtg-ttttttcttccaacttttgcattaatcgacctt |
13110927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University