View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_low_60 (Length: 244)
Name: NF3021_low_60
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_low_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 23 - 239
Target Start/End: Original strand, 35137245 - 35137461
Alignment:
| Q |
23 |
aataacggggagaaaggtcagataacaggagagcaaagaccggcacggtaacaacaggaaaaggaaaatcaatatatgtttatgtatgtgaatgtagtca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35137245 |
aataacggggagaaaggtcagataacaggagagcaaagaccggcacggtaacaacaggaaaaggaaaatcaatatatgtttatgtatgtgaatgtagtca |
35137344 |
T |
|
| Q |
123 |
actttgagagtttaccagataaccatagctggtattttcataatctcccagcaattcagccaaagtttcttggtcttctagaacacgtaaattatctctg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35137345 |
actttgagagtttaccagataaccatagctggtattttcataatctcccagcaattcagccaatgtttcttggtcttctagaacacgtaaattatctctg |
35137444 |
T |
|
| Q |
223 |
tctggacctatgctact |
239 |
Q |
| |
|
|||||||| ||| |||| |
|
|
| T |
35137445 |
tctggaccaatggtact |
35137461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University