View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_low_69 (Length: 237)
Name: NF3021_low_69
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_low_69 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 41100672 - 41100890
Alignment:
| Q |
1 |
attatctcccgcgtcttcgcttttttctcggcaaaaactcttttctttctttaaatggnnnnnnnnngaagaagaagtagaaaaacgtatattcatattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41100672 |
attatctcccgcgtcttcgcttttttctcggcaaaaactctt--ctttctttaaatggaaaaaaaa-gaagaagaagtagaaaaacgtatattcatattc |
41100768 |
T |
|
| Q |
101 |
actcattctttctcttttatcaaacaaactacttactcgtcaagttttcttcattaatttttcaaacagaatgtcgcccccattcgatgattttcgcaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41100769 |
actcattctttctcttttatcaaacaaactacttactcgtccagttttcttcattcatttttcaaacagaatgtcgcccccatttgatgattttcgcaac |
41100868 |
T |
|
| Q |
201 |
ttctttgtgtttataactttct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41100869 |
ttctttgtgtttataactttct |
41100890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University