View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_low_72 (Length: 233)
Name: NF3021_low_72
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_low_72 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 13050857 - 13050652
Alignment:
| Q |
18 |
gttgaagcgctgtatggtcttagta-atgggatcgtttgcaagcatcggtaaacgttttgaaaatgcttactgagtagaactctgcaggttgcaacaaga |
116 |
Q |
| |
|
||||||||||| ||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||| |||| |||| |
|
|
| T |
13050857 |
gttgaagcgctatatggtcttagcatatgggatcgtttgcaagcattggtaaacgttttgaaaatgcttactgagcagaactctacaggtggcaataaga |
13050758 |
T |
 |
| Q |
117 |
aggagaaatgactaatcacgttagggcggttaatgtgccaactggttaatagtcacattcgaataatatggggcttct-gtttgtctccaactactacct |
215 |
Q |
| |
|
|||||||||||||||||| |||||| |||| ||||| |||||||||||| ||||||||| ||||||| ||||||||| |||||||||||||| |||||| |
|
|
| T |
13050757 |
aggagaaatgactaatcatgttaggttggttgatgtgacaactggttaattgtcacattcaaataatacggggcttctggtttgtctccaactgctacct |
13050658 |
T |
 |
| Q |
216 |
atgcta |
221 |
Q |
| |
|
||||| |
|
|
| T |
13050657 |
gtgcta |
13050652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University