View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_low_75 (Length: 228)
Name: NF3021_low_75
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_low_75 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 7 - 228
Target Start/End: Original strand, 39660562 - 39660786
Alignment:
| Q |
7 |
cttagttattgcacttggatgcagtattaataaaatcagaagcttctatcgctacatttttgtcctac---tactaacactactactttaagtctttaac |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
39660562 |
cttagttattgcacttggatgcagtattaataaaatcagaagcttctatcgctacatttttgtactactactactaacactactactttaagtctttaac |
39660661 |
T |
 |
| Q |
104 |
cgagtgtaattataataccatctaaaagcgttgcacacacacttcatggtcaaaatacaccggcaatgaatcagctcatcattacatcattttacaatgc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39660662 |
cgagtgtaattataataccatctaaaagagttgcacacacacttcatggtcaaaatacaccggcaatgaatcagctcatcattacatcattttacaatgc |
39660761 |
T |
 |
| Q |
204 |
tgccttaacagtgaactgaacctct |
228 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39660762 |
tgccttaacagtgaactgaacctct |
39660786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University