View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_low_82 (Length: 212)
Name: NF3021_low_82
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_low_82 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 116 - 197
Target Start/End: Original strand, 35473244 - 35473325
Alignment:
| Q |
116 |
gacggattttagttatgttctaaccannnnnnnagtttgttagtcttatcctcttcccttcctagctgttccctttcctatg |
197 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35473244 |
gacggattttagttatgttctaaccatttttttagtttgttagtctgatcctcttcccttcctagctgttccctttcctatg |
35473325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 21 - 65
Target Start/End: Original strand, 35473199 - 35473243
Alignment:
| Q |
21 |
ataatttcatcttcaagctgggattaaaaagcatatactctccgg |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35473199 |
ataatttcatcttcaagctgggattaaaaagcatatactctccgg |
35473243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University