View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_low_84 (Length: 207)
Name: NF3021_low_84
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_low_84 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 33692825 - 33693015
Alignment:
| Q |
1 |
aagaagcaaaagacaactcacaaatttaaagtggttcggcactccgtaaaaagatgta--atctcacaataaaatattttattactcaacttgcaatttt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33692825 |
aagaagcaaaagacaactcacaaatttaaagtggttcggcactccgtaataagatatacaatctcacaataaaatattttattactcaacttgcaatttt |
33692924 |
T |
|
| Q |
99 |
ttacaatgataaaatggcaaactctcacaactactcaagttttcgataaatcaaatgatttagatttgttgcggtgaagaaaatttaaacc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33692925 |
ttacaatgataaaatggcaaactctcacaactactcaagttttcgatacatcaaatgatttagatttgttgcggtgaagaaaacttaaacc |
33693015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 98
Target Start/End: Complemental strand, 2259173 - 2259133
Alignment:
| Q |
58 |
aatctcacaataaaatattttattactcaacttgcaatttt |
98 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
2259173 |
aatctcacaacaaattattttattactcaacttgcactttt |
2259133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University