View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3021_low_87 (Length: 201)
Name: NF3021_low_87
Description: NF3021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3021_low_87 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 188
Target Start/End: Original strand, 3590517 - 3590694
Alignment:
| Q |
12 |
aaatatatgtctgcctaactctatatacgggatccgttgatctagacttagacttccaaaactgcttcatcaccttcttcctttccccagatgttttgaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3590517 |
aaatatatgtctgcctaactctatatacgggatccgttgatctagacttagacttccaaaactgcttcatcaccttcttcctttccccagatgttttgaa |
3590616 |
T |
 |
| Q |
112 |
tctcattaattcagagaatgataccaatagcaagttcaggattggg-aatggtctgtgtcaatggcgcctatctctgc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3590617 |
tctcattaattcagagaatgataccaatagcaagttcaggattgggaaatggtctgtgtcaatggcgcctatctctgc |
3590694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University