View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3023-Insertion-11 (Length: 145)
Name: NF3023-Insertion-11
Description: NF3023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3023-Insertion-11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 3e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 3e-43
Query Start/End: Original strand, 41 - 145
Target Start/End: Complemental strand, 637435 - 637331
Alignment:
| Q |
41 |
tgttagcgatatatgtagggaaccttatttgtggtgagaaggaagtattacataagcttcttctcttggtgtagttttgtaattgtttttggtgaattgg |
140 |
Q |
| |
|
|||||| ||||||||| | |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
637435 |
tgttagtgatatatgtcgtgaacattatttgtggtgagaaggaagtattacataagcttcttctcttggtgtagttttgtaattgtttttggtgaattgg |
637336 |
T |
 |
| Q |
141 |
ctaca |
145 |
Q |
| |
|
||||| |
|
|
| T |
637335 |
ctaca |
637331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University