View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3023-Insertion-12 (Length: 99)
Name: NF3023-Insertion-12
Description: NF3023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3023-Insertion-12 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 3e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 8 - 99
Target Start/End: Original strand, 4750078 - 4750169
Alignment:
| Q |
8 |
atgagatgctgcgcaaaacaagtatttcatttgcgaactttagacaggcaaaagttgattttaacctcaatggttagtcatttcattccata |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4750078 |
atgagatgctgcgcaaaacaagtatttcatttgcgaactttagacaggcaaaagttgattttaacctcaatggttagtcatttcattccata |
4750169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 5e-19
Query Start/End: Original strand, 8 - 99
Target Start/End: Original strand, 4758398 - 4758489
Alignment:
| Q |
8 |
atgagatgctgcgcaaaacaagtatttcatttgcgaactttagacaggcaaaagttgattttaacctcaatggttagtcatttcattccata |
99 |
Q |
| |
|
||||||||||||||| ||||| || |||||||| || ||||||| ||||||||||||| ||||| |||||||||||| ||| ||||||||| |
|
|
| T |
4758398 |
atgagatgctgcgcataacaacaatctcatttgcaaattttagacgggcaaaagttgatgttaacatcaatggttagttattccattccata |
4758489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University