View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3023R-Insertion-11 (Length: 435)
Name: NF3023R-Insertion-11
Description: NF3023R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3023R-Insertion-11 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 153 - 435
Target Start/End: Complemental strand, 32319001 - 32318719
Alignment:
| Q |
153 |
ttcttcttttgatgtttgactgaagttttatggacaaaagacttgtttattgactgagtggtaaataattacacttagttgagaattgtatatacttact |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32319001 |
ttcttcttttgatgtttgactgaagttttatggtcaaaagacttgtttattgactgagtggtaaataattacatttagttgagaattgtatatacttact |
32318902 |
T |
|
| Q |
253 |
atgattgtgaattcgtgatatcaaagattcagaggagttattctattacgttatgttttactacattcttctacttagttcttttgaagtatttttcaaa |
352 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32318901 |
atgattgtgaatttgtgatatcaaagattctgaggagttattctattacgttctgttttactacattcttctacttagttattttgaagtatttttcaaa |
32318802 |
T |
|
| Q |
353 |
acgattccacgtatttgagggaatcaaattatttgaannnnnnnatgaaaacaattttaagaatttcttctgagattaattgt |
435 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32318801 |
acgattccacgtatttgagggaatcaaattatttgattttttttatgaaaacaattttaagaatttcttctgagattaattgt |
32318719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 32319121 - 32319027
Alignment:
| Q |
10 |
ttttcacttacagaactgagcctccatatttgcacggacgg-ccgtgattatttgtatccctttgcttaattgtgtttgcacttttgctatggtg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32319121 |
ttttcacttacagaactgagcctccatatttgcaggaacgggccgtgattatttgtatccctttgtttaattgtgtttgcacttttgctatggtg |
32319027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University