View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3023R-Insertion-13 (Length: 285)
Name: NF3023R-Insertion-13
Description: NF3023R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3023R-Insertion-13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 9 - 97
Target Start/End: Complemental strand, 5006606 - 5006518
Alignment:
| Q |
9 |
ccgcatgtataaatccacaccgttccagagctttcaaacactagaacaaccgcactgaatattatttatcttatcaggtacaatcacac |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
5006606 |
ccgcatgtataaatccacaccgttccagagctttcaaacactagaacaaccgcgctgaacattatttatctgatcaggtacaatcacac |
5006518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University