View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3023_low_10 (Length: 345)
Name: NF3023_low_10
Description: NF3023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3023_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 126 - 303
Target Start/End: Original strand, 43294038 - 43294211
Alignment:
| Q |
126 |
tacaatgtagtagtagctagctaagacattatcaataactcccagaaagttgcatttaatatagccttgtagatcacaatttgctatctctttggggtat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43294038 |
tacaatgtagtagtagctagctaagacaatatca----------gaaagttgcatttaatatagccttgtagatcacaatttgctatctctttggggtat |
43294127 |
T |
 |
| Q |
226 |
cgtgatcctgatgagaaactggt------atcatctagcttctctatgttaatattgcagtgcaggggaatctctttgtacaag |
303 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43294128 |
cgtgatcctgatgagaaactggtatcatgatcatctagcttctctatgttaatattgcagtgcaggggaatctctttgtacaag |
43294211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 9 - 70
Target Start/End: Original strand, 43293978 - 43294039
Alignment:
| Q |
9 |
agcagagacaatgttgtcaacacttgattttatgttattgaaatttgagctataagtatgta |
70 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43293978 |
agcaaagacaatgttgtcaacacttgattttatattattgaaatttgagctataagtatgta |
43294039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University