View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3023_low_18 (Length: 237)
Name: NF3023_low_18
Description: NF3023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3023_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 637634 - 637429
Alignment:
| Q |
1 |
tttgcacgagttggaattctatcaagattgagcgtccacgagaacgcaatgacctttatatgaaaagttgatcttgcgtgagttatacatgtaaagaacc |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
637634 |
tttgcacgagttgaaattctatcaagattgagcgtccacgagaacgcaatgacctttatatgaaaagttgatcttgcgtgagttatacatgtaaagaacc |
637535 |
T |
|
| Q |
101 |
ctttactctgatgaactactaaaattggtttggtttctgattgcaactcgtctaattgatacgttgttgttttgtggatgttccttgtatgggtcgtggt |
200 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
637534 |
ctttagtctgatgaactactaaaaatggtttggtttctgattgcaactcgtctaattgatacgttgttgttttgtggatgttccttgtatgggtcgtggt |
637435 |
T |
|
| Q |
201 |
gttagt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
637434 |
gttagt |
637429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University