View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3023_low_20 (Length: 231)
Name: NF3023_low_20
Description: NF3023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3023_low_20 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 27848220 - 27848426
Alignment:
| Q |
19 |
agaaaactcattgttggggatgtaggtggaggatatggatatgccggaccaggcgaaggaggtgatggatatggtgtttctcnnnnnnnnnnnnnnnnnn |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27848220 |
agaaaactcattgttggggatgtaggtggaggatatggatatgccggaccaggcgaaggaggtgatggatatggtgtttctcgaggaggaggaggagg-- |
27848317 |
T |
|
| Q |
119 |
nnnncgaagcaggcggtggatatggtcctgatggaccaggtacgggaagtggtggatttgttcctggttacccgggtgtaggaggtggtggatttgttcc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27848318 |
----cgaagcaggcggtggatatggtcctgatggaccaggtacgggaagtggtggatttgttcctggttacccgggtgtaggaggtggtggatttgttcc |
27848413 |
T |
|
| Q |
219 |
tggggtaggaggc |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
27848414 |
tggggtaggaggc |
27848426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University