View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3023_low_9 (Length: 348)
Name: NF3023_low_9
Description: NF3023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3023_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 10 - 331
Target Start/End: Original strand, 40399367 - 40399688
Alignment:
| Q |
10 |
aagaagaaggaatcggtcgaagttcgggaaccgagagtcgtgtccatcacaacaagaccgaagatctcatatcataacggatcatttaacgacttcactg |
109 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40399367 |
aagaagaaggaatcggtcgaagttcggcaaccgagagtcgtgtccatcacaacaagaccgaagatctcatatcataacggatcatttaacgatttcactg |
40399466 |
T |
|
| Q |
110 |
aggatgttgacctcattcccctttggtggaaaatatctctaatttagaattgttacaaagaaagtatttctctccaaaatcaacccaaccaaagaagtag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40399467 |
aggatgttgacctcattcccctttggtggaaaatatctctaatttagaattgttacaaagaaagtatttctctccaaaatcaacccaaccaaagaagtag |
40399566 |
T |
|
| Q |
210 |
tacaaatattgtcgtggttttgccttttggaaatggcagggaacaaacaggccccaaaattttgaatttcacatgcgtctctttttcttattactagtat |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40399567 |
tacaaatattgtcgtggttttgccttttggaaatggcagggaacaaactggccccaaaattttgaatttcacatgcttctctttttcttattactagtat |
40399666 |
T |
|
| Q |
310 |
gacgcaccaaccatagattaaa |
331 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40399667 |
gacgcaccaaccatagattaaa |
40399688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University