View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3024_low_18 (Length: 224)
Name: NF3024_low_18
Description: NF3024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3024_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 24140047 - 24139836
Alignment:
| Q |
1 |
tgtttagagggtaaattttggggtttgacattgactcgaagagtgcactttactttatcatatcatgtgacgggctactgcatgagatgaacattggtgc |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24140047 |
tgtttagagagtaaattttggggtttgacaccgactcgaagagtgcactttactttatcatatcatgtgacgggctactgcatgagatgaacattggtgc |
24139948 |
T |
|
| Q |
101 |
actttactttgaatgattctttgtaatgtagcattatgagaaggcattaatatacaagactaatttttcaattaacatttgatactgatactgctgatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24139947 |
actttactttgaatgattctttgtaatgtagcattatgagaaggcatta--atacaagactaatttttcaattaacatttgatactgatactgctggtat |
24139850 |
T |
|
| Q |
201 |
tgatggatatgatg |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
24139849 |
tgatggatatgatg |
24139836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 23 - 65
Target Start/End: Original strand, 21233111 - 21233153
Alignment:
| Q |
23 |
gtttgacattgactcgaagagtgcactttactttatcatatca |
65 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
21233111 |
gtttgacactgactcgaagagtgcactttactttatcgtatca |
21233153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 57
Target Start/End: Original strand, 17454750 - 17454790
Alignment:
| Q |
17 |
tttggggtttgacattgactcgaagagtgcactttacttta |
57 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
17454750 |
tttggagtttgacattgattcgaagagtgcactttacttta |
17454790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University