View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3025_high_14 (Length: 334)
Name: NF3025_high_14
Description: NF3025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3025_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 37 - 326
Target Start/End: Original strand, 3783715 - 3784004
Alignment:
| Q |
37 |
attaaatcattaatttatttcttgtgtatatctctctcgtaaataaacaaacatgccatggatcactttgaggtatgagtatcaagcgtgcttggtgcgt |
136 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3783715 |
attaaatcactaatttatttcttgtgtatatctctctcgtaaataaacaaacatgccatggatcactttgaggtatgagtatcaagcgtgcttggtgcgt |
3783814 |
T |
 |
| Q |
137 |
actggttactgcatggtgagctgtctgaccactatgttctttacctgtctccacttccaatagtatcccctctccttattgtcttccttcttaaagaaaa |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3783815 |
actggttactgcatggtgagctgtctgaccactatgttctttacctgtctccacttccaatagtatcccctctccttattgtcttccttcttaaagaaaa |
3783914 |
T |
 |
| Q |
237 |
caaaagacaaaccaaagacataaaatgcgcacaacatagacatacatagcgacaaactcattcacaaaatcactttaattttcctatgct |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3783915 |
caaaagacaaaccaaagacataaaatgcgcacaacatagacatacatagcgacaaactcattcacaaaatcactttaattttcctatgct |
3784004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University