View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3025_high_22 (Length: 280)
Name: NF3025_high_22
Description: NF3025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3025_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 38886039 - 38885789
Alignment:
| Q |
18 |
tttacaaggttgtggaagtgtttgggttgaaagtgagagaatgccacaacaactttatgttcagtttgctgaaatggaaaatgggaatggatttgagtgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38886039 |
tttacaaggttgtggaagtgtttgggttgaaagtgagagaatgccacaacaactttatgttcagtttgctgaaatggaaaatgggaatggatttgagtgt |
38885940 |
T |
|
| Q |
118 |
gtcgggaatggtgagtttattgtgattatgattaaaggaagtgataagggtttggtttatgatattggaaggaagagatggcagtggattccaccttgtc |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38885939 |
gttgggaatggtgagtttattgtgattatgattaaaggaagtgataagggtttggtttatgatattggaaggaagagatggcagtggattccaccttgtc |
38885840 |
T |
|
| Q |
218 |
cttatgctggttatgatgggtttgagttgcatggttttgcttatgagccta |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38885839 |
cttatgctggttatgatgggtttgagttgcatggttttgcttatgagccta |
38885789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 225 - 268
Target Start/End: Original strand, 2996437 - 2996480
Alignment:
| Q |
225 |
tggttatgatgggtttgagttgcatggttttgcttatgagccta |
268 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2996437 |
tggttatgatgggtttgagttgcatggtcttgcttatgagccta |
2996480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 229 - 268
Target Start/End: Complemental strand, 2980137 - 2980098
Alignment:
| Q |
229 |
tatgatgggtttgagttgcatggttttgcttatgagccta |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2980137 |
tatgatgggtttgagttgcatggttttgcttatgaaccta |
2980098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 233 - 268
Target Start/End: Complemental strand, 2984009 - 2983974
Alignment:
| Q |
233 |
atgggtttgagttgcatggttttgcttatgagccta |
268 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2984009 |
atgggtttgagttgcatgattttgcttatgagccta |
2983974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University