View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3025_high_28 (Length: 227)
Name: NF3025_high_28
Description: NF3025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3025_high_28 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 2 - 227
Target Start/End: Complemental strand, 6816058 - 6815833
Alignment:
| Q |
2 |
catccaactgagtagattgcaaaccaatatcagataaaagcacgctagatatacctaaccactttaaaacgaaggaccaaactacttcccnnnnnnntcg |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
6816058 |
catccaactgagaagattgcaaaccaatatcagatgaaagcacgctagatatccctaaccacttcaaaacgaaggaccaaactacttcccaaaaaaatcg |
6815959 |
T |
 |
| Q |
102 |
aaatccaagaagacatgattcaccacattctaccatcccacaatcacccgagcataacaaagatcttggttgaagaactccatgatgaattaaattatat |
201 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6815958 |
aaatccaagaagacatgattcaccatattctaccatcccacaatcacccgagcataacaacgatcttggttgaagaactccatgatgaattaaattatat |
6815859 |
T |
 |
| Q |
202 |
ttagttgaaagtctttaattcaacaa |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6815858 |
ttagttgaaagtctttaattcaacaa |
6815833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University