View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3025_low_19 (Length: 319)
Name: NF3025_low_19
Description: NF3025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3025_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 20 - 305
Target Start/End: Complemental strand, 47119329 - 47119044
Alignment:
| Q |
20 |
agccgggaccaagggaactactttagaaagtccactaggacgccctgagtttgctctagcagatggaggttgatcattgttcacattattggattgagcc |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47119329 |
agccggaaccaagggaactactttagaaagtccactaggacgccctgagtttgctctagcagatggaggttgatcattgttcacattattggattgagcc |
47119230 |
T |
|
| Q |
120 |
gatcgagacatagctaaactgcgtgcagagggagacaaatcaaaggttcgatttgtcgttgttgaacgagcagagggtggttgttgctccccctgattgg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47119229 |
gatcgagacatagctaaactgcgtgcagagggagacaaatcaaaggttcgatttgtcgttgttgaacgagcagagggtggttgttgctccccctgattgg |
47119130 |
T |
|
| Q |
220 |
catgcgtggagattcgtggtggagtttgctcagcagtatttgcagagaaagacgatcgaacactagatatagttcttaaagattga |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47119129 |
catgcgtggagattcgtggtggagtttgctcagcagtatttgcagagaaagacgatcgaacactagatatagttcttaaagattga |
47119044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University