View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3025_low_33 (Length: 227)

Name: NF3025_low_33
Description: NF3025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3025_low_33
NF3025_low_33
[»] chr5 (1 HSPs)
chr5 (2-227)||(6815833-6816058)


Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 2 - 227
Target Start/End: Complemental strand, 6816058 - 6815833
Alignment:
2 catccaactgagtagattgcaaaccaatatcagataaaagcacgctagatatacctaaccactttaaaacgaaggaccaaactacttcccnnnnnnntcg 101  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||||||       |||    
6816058 catccaactgagaagattgcaaaccaatatcagatgaaagcacgctagatatccctaaccacttcaaaacgaaggaccaaactacttcccaaaaaaatcg 6815959  T
102 aaatccaagaagacatgattcaccacattctaccatcccacaatcacccgagcataacaaagatcttggttgaagaactccatgatgaattaaattatat 201  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
6815958 aaatccaagaagacatgattcaccatattctaccatcccacaatcacccgagcataacaacgatcttggttgaagaactccatgatgaattaaattatat 6815859  T
202 ttagttgaaagtctttaattcaacaa 227  Q
    ||||||||||||||||||||||||||    
6815858 ttagttgaaagtctttaattcaacaa 6815833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University