View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3025_low_35 (Length: 203)
Name: NF3025_low_35
Description: NF3025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3025_low_35 |
 | |
|
| [»] scaffold0907 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0907 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: scaffold0907
Description:
Target: scaffold0907; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 20 - 185
Target Start/End: Complemental strand, 2817 - 2653
Alignment:
| Q |
20 |
aatcgtaactcacgtgacttctaggtcttgttctagatgatcgcgtggatattaactagttgtataaataagttctagtagtatttgactatgtgatgta |
119 |
Q |
| |
|
|||||||||| |||||| |||||| ||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2817 |
aatcgtaactaacgtgatttctagttctaattctagatggtcacgtggatattaactagttgtataaataagttctagtagtatttgactatgtgatgta |
2718 |
T |
|
| Q |
120 |
attggtatttggtaagtatatgtctggaccgacgatgagtatgatagaatcacggtgtgttatcca |
185 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
2717 |
attggtatttggtaagtatatgt-tggtccgacgatgagtatgatagaatcatggtgtgttgtcca |
2653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University