View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3028_low_10 (Length: 405)
Name: NF3028_low_10
Description: NF3028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3028_low_10 |
 |  |
|
| [»] chr7 (180 HSPs) |
 |  |
|
| [»] chr6 (121 HSPs) |
 |  |
|
| [»] chr5 (184 HSPs) |
 |  |
|
| [»] chr2 (147 HSPs) |
 |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |
|
| [»] chr8 (168 HSPs) |
 |  |
|
| [»] chr1 (195 HSPs) |
 |  |
|
| [»] scaffold0864 (2 HSPs) |
 |  |
|
| [»] scaffold0014 (3 HSPs) |
 |  |
|
| [»] scaffold0283 (2 HSPs) |
 |  |
|
| [»] scaffold0594 (2 HSPs) |
 |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |
|
| [»] scaffold0922 (1 HSPs) |
 |  |
|
| [»] scaffold0606 (1 HSPs) |
 |  |
|
| [»] scaffold0474 (2 HSPs) |
 |  |  |
|
| [»] scaffold0370 (4 HSPs) |
 |  |
|
| [»] scaffold0272 (4 HSPs) |
 |  |
|
| [»] scaffold0182 (3 HSPs) |
 |  |
|
| [»] scaffold0122 (2 HSPs) |
 |  |
|
| [»] scaffold0035 (2 HSPs) |
 |  |
|
| [»] scaffold0022 (2 HSPs) |
 |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |
|
| [»] scaffold0951 (1 HSPs) |
 |  |  |
|
| [»] scaffold0777 (1 HSPs) |
 |  |
|
| [»] scaffold0352 (2 HSPs) |
 |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |
|
| [»] scaffold0213 (2 HSPs) |
 |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |
|
| [»] scaffold1171 (1 HSPs) |
 |  |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |
|
| [»] scaffold1067 (2 HSPs) |
 |  |
|
| [»] scaffold0693 (2 HSPs) |
 |  |  |
|
| [»] scaffold0592 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (2 HSPs) |
 |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0227 (1 HSPs) |
 |  |
|
| [»] scaffold2010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
| [»] scaffold0279 (1 HSPs) |
 |  |  |
|
| [»] scaffold0236 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
| [»] scaffold0097 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 337; Significance: 0; HSPs: 198)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 22 - 403
Target Start/End: Complemental strand, 24636984 - 24636601
Alignment:
| Q |
22 |
gctattcccccaagatttatgaggttgacattgactcaggttgtgaccacacttgggttcagtgtgatgcaccatgtataggttttatcaaggtgaagtc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24636984 |
gctattcccccaagatttatgaggttgacattgactcagtttgtgaccacacttgggttcagtgtgatgcaccatgtaaaggttttatcaaggtgaagtc |
24636885 |
T |
 |
| Q |
122 |
aaacttagatcaggcatcattctgatgtgtgaatgaatgctgggcagtccataatttcaactctttacattgtgatttgaaaggtttttcaaataaatta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24636884 |
aaacttagatcaggcatcattctgatgtgtgaatgaatactgggcagtccataatttcaactctttacattgtgatttgaaaggtttttcaaataaatta |
24636785 |
T |
 |
| Q |
222 |
aatttagcactcaaaataatttggttaacaagtgtttat--atatggaaggagagaaacaaacttattttccaacaaaaggaaaattacatccgtacaat |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24636784 |
aatttagcactcaaaataatttggttaacaactgtttatatatatggaaggagagaaacaaacttattttccaacaaaaggaaaattacatccgttcaat |
24636685 |
T |
 |
| Q |
320 |
tagttagcatggtaaaaataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
24636684 |
tagttagcatggtaaaaataataaaataaagacttaattgtacttttggatccttatcttttcaaaagttgcggttatggaccc |
24636601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 37 - 150
Target Start/End: Complemental strand, 24715505 - 24715390
Alignment:
| Q |
37 |
tttatgaggttgacattgactcaggttgtgaccacacttgggttcagtgtgatg--caccatgtataggttttatcaaggtgaagtcaaacttagatcag |
134 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||||| |||| |||| ||||| ||||||| ||||||||||||||| | | |
|
|
| T |
24715505 |
tttatgacgttgacattgactcaggttgtgacagcacttgggttcagtgtgatgcacaccttgtaaaggttgcatcaaggcgaagtcaaacttagacctg |
24715406 |
T |
 |
| Q |
135 |
gcatcattctgatgtg |
150 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
24715405 |
gtatcattctgatgtg |
24715390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 341 - 405
Target Start/End: Original strand, 29168720 - 29168784
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29168720 |
taaaataaagatttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
29168784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 17483563 - 17483616
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17483563 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
17483616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 340 - 405
Target Start/End: Original strand, 27766508 - 27766573
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27766508 |
ataaaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27766573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 341 - 405
Target Start/End: Complemental strand, 30761122 - 30761058
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30761122 |
taaaataaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
30761058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 341 - 405
Target Start/End: Complemental strand, 33576731 - 33576667
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33576731 |
taaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
33576667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 350 - 405
Target Start/End: Original strand, 8727913 - 8727968
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8727913 |
gacttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
8727968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 350 - 405
Target Start/End: Original strand, 9079800 - 9079855
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9079800 |
gacttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
9079855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 350 - 405
Target Start/End: Complemental strand, 41223826 - 41223771
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41223826 |
gacttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
41223771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 342 - 405
Target Start/End: Complemental strand, 47530661 - 47530598
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
47530661 |
aaaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47530598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 335 - 405
Target Start/End: Original strand, 19391623 - 19391693
Alignment:
| Q |
335 |
aaataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||| | || ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
19391623 |
aaataataaaacataggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19391693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 348 - 402
Target Start/End: Complemental strand, 31577735 - 31577681
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31577735 |
aagacttaattgcacttttggacccctatctttttaaaagttgtggttatggacc |
31577681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 257747 - 257694
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
257747 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
257694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 19914478 - 19914531
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19914478 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
19914531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 25126309 - 25126256
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25126309 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
25126256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 336 - 405
Target Start/End: Complemental strand, 28097751 - 28097682
Alignment:
| Q |
336 |
aataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| ||| |||| ||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28097751 |
aataattaaaaaaaggcttaattccacttttggacccctatcttttcaaaagttgcggttatggacccct |
28097682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 28964465 - 28964412
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28964465 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
28964412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 31117622 - 31117675
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31117622 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31117675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 41281847 - 41281900
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41281847 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
41281900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 41282158 - 41282105
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41282158 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
41282105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 45760544 - 45760491
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45760544 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45760491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 47943771 - 47943718
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47943771 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
47943718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 337 - 405
Target Start/End: Original strand, 2118700 - 2118768
Alignment:
| Q |
337 |
ataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||| ||| ||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2118700 |
ataaaaaaatgaaggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
2118768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 349 - 405
Target Start/End: Complemental strand, 33622180 - 33622124
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
33622180 |
agacttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
33622124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 341 - 405
Target Start/End: Original strand, 37181995 - 37182059
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
37181995 |
taaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37182059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 41223509 - 41223568
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
41223509 |
taaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatagacccct |
41223568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 41722295 - 41722244
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41722295 |
cttaattgcacttttgaacccctatcttttcaaaagttgtggttatggaccc |
41722244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 2239546 - 2239488
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
2239546 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
2239488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 17916399 - 17916341
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
17916399 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
17916341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 352 - 402
Target Start/End: Complemental strand, 32205158 - 32205108
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32205158 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
32205108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 53192111 - 53192169
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
53192111 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53192169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 787101 - 787154
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
787101 |
cttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
787154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 401
Target Start/End: Complemental strand, 2119025 - 2118976
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2119025 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
2118976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 2239229 - 2239282
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2239229 |
cttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
2239282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 3212463 - 3212410
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
3212463 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
3212410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 5577244 - 5577191
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
5577244 |
cttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
5577191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 8313951 - 8314004
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
8313951 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
8314004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 10864117 - 10864170
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
10864117 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
10864170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 17483869 - 17483816
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
17483869 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
17483816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 19392014 - 19391961
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
19392014 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19391961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 19914783 - 19914730
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
19914783 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19914730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 21841729 - 21841782
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
21841729 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatggccccct |
21841782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 22202486 - 22202539
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22202486 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
22202539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 401
Target Start/End: Original strand, 24636352 - 24636401
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24636352 |
cttaattgtacttttggacccctatcttttcaaaagttgtggttatggac |
24636401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 27748554 - 27748501
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27748554 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27748501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 27766828 - 27766775
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27766828 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27766775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 27857446 - 27857393
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27857446 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27857393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 28097419 - 28097472
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28097419 |
cttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
28097472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 28964155 - 28964208
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
28964155 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28964208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 33621868 - 33621921
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
33621868 |
cttaattgcacttttggacccctatctttacaaaagttgcggttatggacccct |
33621921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 36373862 - 36373805
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
36373862 |
taaaggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggaccc |
36373805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 38511968 - 38511915
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
38511968 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatagacccct |
38511915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 42230342 - 42230289
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
42230342 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42230289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 44177290 - 44177343
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
44177290 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44177343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 44177596 - 44177543
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44177596 |
cttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
44177543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 44183974 - 44184027
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
44183974 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44184027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 44184282 - 44184229
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
44184282 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44184229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 44624537 - 44624484
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44624537 |
cttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
44624484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 44895959 - 44895906
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
44895959 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44895906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 45743901 - 45743954
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
45743901 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
45743954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 47530341 - 47530394
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
47530341 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47530394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 47943461 - 47943514
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
47943461 |
cttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
47943514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 49997967 - 49997914
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
49997967 |
cttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
49997914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 50033552 - 50033499
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
50033552 |
cttaattgcacttttggacccctatcttttcaaaggttgcggttatggacccct |
50033499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 52916861 - 52916914
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
52916861 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52916914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 53531808 - 53531861
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
53531808 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttaaggacccct |
53531861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 53532117 - 53532064
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
53532117 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53532064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 2205540 - 2205592
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2205540 |
ttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
2205592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 350 - 398
Target Start/End: Complemental strand, 27719999 - 27719951
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27719999 |
gacttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
27719951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 30200419 - 30200471
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
30200419 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30200471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 32507924 - 32507980
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
32507924 |
aaaggcttaattgcacttttggacccctattttttcaaaagttgcggttatggaccc |
32507980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 33252795 - 33252743
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
33252795 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
33252743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 352 - 404
Target Start/End: Original strand, 51213309 - 51213361
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
51213309 |
cttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccc |
51213361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 52613646 - 52613586
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52613646 |
aataaaaaaaatgcttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
52613586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 53422092 - 53422144
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
53422092 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53422144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 342 - 401
Target Start/End: Original strand, 9153469 - 9153528
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
9153469 |
aaaacaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttaaggac |
9153528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 24393687 - 24393746
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccc-tatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
24393687 |
aaaggcttaattgcacttttggaccccctatctttttaaaagttgtggttatggacccct |
24393746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 24394003 - 24393952
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24394003 |
cttaattgcacttttggattcctatcttttcaaaagttgtggttatggaccc |
24393952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 346 - 401
Target Start/End: Original strand, 26494681 - 26494736
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
26494681 |
taaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
26494736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 38511661 - 38511712
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
38511661 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggaccc |
38511712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 338 - 405
Target Start/End: Original strand, 44895637 - 44895704
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| | || |||||||||||||||||||||||||||||| |||||||| | |||||||||||| |
|
|
| T |
44895637 |
taataaaaaataggcttaattgcacttttggacccctatctttttaaaagttgcgattatggacccct |
44895704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 342 - 405
Target Start/End: Complemental strand, 51843123 - 51843060
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
51843123 |
aaaaaaaagccttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
51843060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 787416 - 787358
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
787416 |
aaagacttaattgcacttttggatccctatttttccaaaagttgcggttatggacccct |
787358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 339 - 405
Target Start/End: Complemental strand, 8315405 - 8315339
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||| |||||||||||||||| |||||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
8315405 |
aatataataaaggcttaattgcacttttgaacccctattttttcaaaagttgcggttatagacccct |
8315339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 41722051 - 41722109
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
41722051 |
aaaggcttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
41722109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 352 - 402
Target Start/End: Complemental strand, 53192424 - 53192374
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
53192424 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
53192374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 336 - 405
Target Start/End: Original strand, 5576919 - 5576988
Alignment:
| Q |
336 |
aataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||| ||| |||||||| ||||||||||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
5576919 |
aataaaaaaatcaaggcttaattgtacttttggacccctatctttttaaaagttgcggttatgcacccct |
5576988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 9630770 - 9630823
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||| |||||| |
|
|
| T |
9630770 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatgaacccct |
9630823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 9633709 - 9633656
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
9633709 |
cttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
9633656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 10439288 - 10439341
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
10439288 |
cttaattgcacttttggacctctatttttttaaaagttgtggttatggacccct |
10439341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 11961867 - 11961920
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
11961867 |
cttaattgcacttttggacccctaacttttcaaaagttgcggttacggacccct |
11961920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 12881237 - 12881290
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
12881237 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
12881290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 12881526 - 12881473
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
12881526 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
12881473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 27748246 - 27748299
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
27748246 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
27748299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 31869506 - 31869453
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
31869506 |
cttaattgcacttttggacccctatctttccaaaagttgcggttttggacccct |
31869453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 32508230 - 32508177
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
32508230 |
cttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
32508177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 36441635 - 36441582
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
36441635 |
cttaattgcacttttgaatccctatcttttcaaaagttgcggttatggacccct |
36441582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 42465693 - 42465746
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
42465693 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggtcccct |
42465746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 51214470 - 51214417
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
51214470 |
cttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
51214417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 10439590 - 10439538
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
10439590 |
ttaattgcatttttggacccttatcttttcaaaagttgcggttatggacccct |
10439538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 405
Target Start/End: Complemental strand, 11963047 - 11962983
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||| |||| ||||||||| ||||| |||||||| |
|
|
| T |
11963047 |
taaattaaaggcttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
11962983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 352 - 400
Target Start/End: Original strand, 27984141 - 27984189
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
27984141 |
cttaattgcacttttggacccctatctttttaaaagttgcggttatgga |
27984189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 32593779 - 32593839
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||| |||||||| |||||||| |
|
|
| T |
32593779 |
aataaaataaaggtttaattgcacttttggacctctatcttttaaaaagttgcggttatgg |
32593839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 32594079 - 32594027
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
32594079 |
ttaattgtacttttggacctctatcttttcaaaagttgtggttatggccccct |
32594027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 33576410 - 33576462
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
33576410 |
ttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
33576462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 47423150 - 47423202
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
47423150 |
ttaattgcacttttggacccttatcttttcaaaagttgcggttatggccccct |
47423202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 7858279 - 7858220
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
7858279 |
taaaggcttaattgcacttttggatccctatctttccaaaagttgcggttatggccccct |
7858220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 399
Target Start/End: Complemental strand, 20982570 - 20982523
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
20982570 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
20982523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 399
Target Start/End: Complemental strand, 25053895 - 25053848
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
25053895 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
25053848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 399
Target Start/End: Complemental strand, 47423439 - 47423392
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
47423439 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
47423392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 353 - 400
Target Start/End: Original strand, 53190964 - 53191011
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
53190964 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
53191011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 402
Target Start/End: Complemental strand, 3384299 - 3384249
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| ||||||||||| |
|
|
| T |
3384299 |
cttaattgcacttttgaacccctatctttccaaaagttgcggttatggacc |
3384249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 402
Target Start/End: Complemental strand, 27984443 - 27984393
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
27984443 |
cttaattacacttttggacccctatctttccaaaagttgcggttatggacc |
27984393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 398
Target Start/End: Original strand, 40082214 - 40082260
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
40082214 |
cttaattgcacttttggacacctatcttttcaaaagttgcggttatg |
40082260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 42230030 - 42230088
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||| ||||||||| ||||||||| |||| |
|
|
| T |
42230030 |
aaaggcttaattgcacttttggacctctatctttccaaaagttgcggttatggatccct |
42230088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 398
Target Start/End: Original strand, 51336892 - 51336938
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
51336892 |
cttaattgcacttttggactcctatcttttcaaaagttgcggttatg |
51336938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 10864430 - 10864377
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||| |||||| |
|
|
| T |
10864430 |
cttaattgcacttttggacccctatctttccaaaagttgcagttatgaacccct |
10864377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 360 - 405
Target Start/End: Complemental strand, 14133924 - 14133879
Alignment:
| Q |
360 |
cacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
14133924 |
cacttttggacccctatctttccaaaagttgtggttatggccccct |
14133879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 20982282 - 20982335
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
20982282 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggccccct |
20982335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 21842022 - 21841969
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| |||||||| ||||| |
|
|
| T |
21842022 |
cttaattgcacttttagacctctatcttttcaaaagttgcggttatggccccct |
21841969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 29169039 - 29168986
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
29169039 |
cttaattgcacttttagacatctatcttttcaaaagttgcggttatggacccct |
29168986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 30200725 - 30200672
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
30200725 |
cttaattgcacttttagactcctatctttccaaaagttgcggttatggacccct |
30200672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 31117930 - 31117877
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
31117930 |
cttaattgcaattttggacccatatctttttaaaaattgtggttatggacccct |
31117877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 32204850 - 32204903
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| | |||||||||||| |
|
|
| T |
32204850 |
cttaattgcacttttggacctctatctttccaaaagttgcgcttatggacccct |
32204903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 37182310 - 37182257
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37182310 |
cttaattgcggttatggacccctatcttttcaaaagttgcggttatggacccct |
37182257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 45744210 - 45744157
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| | |||||||| ||||||||| |||||||||||||| |
|
|
| T |
45744210 |
cttaattgcacttttggatctctatctttccaaaagttgcggttatggacccct |
45744157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 45760234 - 45760287
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
45760234 |
cttaattgcactttttgacctctatctttccaaaagttgcggttatggacccct |
45760287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 340 - 405
Target Start/End: Original strand, 47722139 - 47722204
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| |||| ||||||||||||||| |||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
47722139 |
ataaaacaaaggtttaattgcacttttgaacccctatctttccaaaagttgcggttatggatccct |
47722204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 49997657 - 49997710
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| ||||||||| |||| |
|
|
| T |
49997657 |
cttaattgcacttttggacccctatttttccaaaagttgcggttatggatccct |
49997710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 51842803 - 51842856
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| || | |||||||||||||||||| |||||||||||||| |
|
|
| T |
51842803 |
cttaattgcacttttagatctctatcttttcaaaagttgcggttatggacccct |
51842856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 52917630 - 52917577
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
52917630 |
cttaattgcacttttgggcccctatctttccaaaagttgcggttatggatccct |
52917577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 53191274 - 53191221
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
53191274 |
cttaattgcatttttggacccctatctttccaaaagttgcggttatggatccct |
53191221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 5153784 - 5153836
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
5153784 |
ttaattgcacttttggacctctatctttttaaaagttacggttatggacccct |
5153836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 22202793 - 22202741
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||| |||| |
|
|
| T |
22202793 |
ttaattgcacttttggatccctatcttttcaaaagttacggttatggatccct |
22202741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 405
Target Start/End: Complemental strand, 25782975 - 25782911
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||| ||||||||||||||| ||| | ||||||| ||||||||| |||||||||||||| |
|
|
| T |
25782975 |
taaaaaaaaggcttaattgcacttttagacacttatctttccaaaagttgcggttatggacccct |
25782911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 48160486 - 48160538
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
48160486 |
ttaattgcatatttggacccctatcttttcaaaagttgcggttatggatccct |
48160538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 352 - 392
Target Start/End: Original strand, 54716478 - 54716518
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtg |
392 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54716478 |
cttaattgcacttttggccccctatcttttcaaaagttgtg |
54716518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 350 - 405
Target Start/End: Complemental strand, 9153790 - 9153735
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
9153790 |
gacttaattgcacttttggactcctatctttctaaaagttacggttatggacccct |
9153735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 9793230 - 9793179
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||| ||| |||||||||||| |
|
|
| T |
9793230 |
cttaattgcacttttggactcttatcttttcaaaaattgcggttatggaccc |
9793179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 405
Target Start/End: Complemental strand, 32459104 - 32459041
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| |||||||||| ||||||| | |||||||| ||||||||| |||||||||||||| |
|
|
| T |
32459104 |
aaaaaaaaggcttaattgcatttttggatctctatctttccaaaagttgcggttatggacccct |
32459041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 351 - 398
Target Start/End: Original strand, 39905729 - 39905776
Alignment:
| Q |
351 |
acttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
39905729 |
acttaattgcactttttgacctctatcttttcaaaagttgcggttatg |
39905776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 347 - 398
Target Start/End: Complemental strand, 40082506 - 40082455
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
40082506 |
aaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
40082455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 51860336 - 51860386
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
51860336 |
cttaattgcatttttggacccctatcttttc-aaagttgcggttatggaccc |
51860386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 398
Target Start/End: Original strand, 2711703 - 2711749
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
2711703 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatg |
2711749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 355 - 405
Target Start/End: Original strand, 3212158 - 3212208
Alignment:
| Q |
355 |
aattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
3212158 |
aattgcacttttggacccctatctttctaaaagttgcggttatgaacccct |
3212208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 344 - 390
Target Start/End: Original strand, 5049358 - 5049403
Alignment:
| Q |
344 |
aataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
5049358 |
aataaagacttaattgcacttttgg-cccttatcttttcaaaagttg |
5049403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 402
Target Start/End: Complemental strand, 5154092 - 5154042
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||||||||||||||||||| |||| ||| ||||||||| ||||||||||| |
|
|
| T |
5154092 |
cttaattgcacttttggaccactatttttccaaaagttgcggttatggacc |
5154042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 7857983 - 7858021
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7857983 |
cttaattgtacttttggacccctatcttttcaaaagttg |
7858021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 339 - 405
Target Start/End: Complemental strand, 9588438 - 9588372
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| || ||||||||||||||||| ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
9588438 |
aataaaatttaggcttaattgcacttttgggcccttatcttttcaaaagttgcatttatggacccct |
9588372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 353 - 403
Target Start/End: Original strand, 9792924 - 9792974
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||| |||||| ||||| |
|
|
| T |
9792924 |
ttaattgcacttttgaacccctttcttttcaaaagttgcggttatagaccc |
9792974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 14015454 - 14015408
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14015454 |
cttaagtgtacttttggacccctatcttttcaaaagttgcggttatg |
14015408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 353 - 399
Target Start/End: Complemental strand, 26012978 - 26012932
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
26012978 |
ttaattgcatttttggactcctatcttttcaaaagttgcggttatgg |
26012932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 36017077 - 36017019
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||| ||||||| ||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
36017077 |
aaaggcttaatttcacttttagacccctatctttccaaaagttgcggttatgcacccct |
36017019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 43679013 - 43678967
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||| ||||||| |
|
|
| T |
43679013 |
cttaattgcacttttggacacctatattttcaaaagttgcggttatg |
43678967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 46934041 - 46934079
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46934041 |
cttaattgcacttttggccccctatcttttcaaaagttg |
46934079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 49859762 - 49859716
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
49859762 |
cttaattgtacttttggacctctatcttttcaaaagttgcggttatg |
49859716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 389
Target Start/End: Complemental strand, 14004145 - 14004108
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14004145 |
cttaattgcacttttggatccctatcttttcaaaagtt |
14004108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 25782655 - 25782708
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||||||||| ||| ||||||||| ||||||| |||||| |
|
|
| T |
25782655 |
cttaattgcactttttgacccctatttttccaaaagttgcggttatgaacccct |
25782708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 27448816 - 27448869
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| ||||||| |||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
27448816 |
cttaattgtacttttgaacccctatctttccaaaagttgcggttatggtcccct |
27448869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 33252486 - 33252539
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| | |||||||||||| |
|
|
| T |
33252486 |
cttaattgtacttttggacccctatctttctaaaagttgcgattatggacccct |
33252539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 33933679 - 33933626
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||| ||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
33933679 |
cttaattgcaattttggccccctatctttccaaaagttgcggttatagacccct |
33933626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 353 - 398
Target Start/End: Original strand, 34942740 - 34942785
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
34942740 |
ttaattgtacttttggactcctatcttttcaaaagttgcggttatg |
34942785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 34943026 - 34942974
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
34943026 |
cttaattgcacttttggatcc-tatctttttaaaagttgtggttatggtcccct |
34942974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 401
Target Start/End: Original strand, 36441484 - 36441533
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| |||||||||| |
|
|
| T |
36441484 |
cttaattgcacttttggactcctatctttctaaaagttgcggttatggac |
36441533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 46934299 - 46934246
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| | |||||| ||||| |
|
|
| T |
46934299 |
cttaattgcacttttggccccctatctttccaaaagttgcgattatggccccct |
46934246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 401
Target Start/End: Complemental strand, 47722461 - 47722412
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||||||| | |||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
47722461 |
cttaattgtatttttggactcctatcttttcaaaagttgcggttatggac |
47722412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 54718164 - 54718115
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
54718164 |
aaaggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
54718115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 257441 - 257493
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| | |||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
257441 |
ttaattgtatttttggactcctatcttttcaaaagttgcggttatgaacccct |
257493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 397
Target Start/End: Complemental strand, 2205838 - 2205794
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||| |||||| |
|
|
| T |
2205838 |
ttaattgcacttttggacccctatctttccaaaaattgcggttat |
2205794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 401
Target Start/End: Original strand, 7818936 - 7818984
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| |||||||||| |
|
|
| T |
7818936 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggac |
7818984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 389
Target Start/End: Complemental strand, 8728222 - 8728186
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8728222 |
ttaattgcacttttggacccctatctttccaaaagtt |
8728186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 389
Target Start/End: Complemental strand, 9080109 - 9080073
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9080109 |
ttaattgcacttttggacccctatctttccaaaagtt |
9080073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 388
Target Start/End: Original strand, 14904444 - 14904480
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagt |
388 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14904444 |
cttaattgcacttttggacccctatctttccaaaagt |
14904480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 25053606 - 25053658
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| || ||| ||||||||||||| |||||||| ||||| |
|
|
| T |
25053606 |
ttaattgcacttttggatccttattttttcaaaagttgcggttatggccccct |
25053658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 31577423 - 31577474
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
31577423 |
ttaattgcacttttg-acccctatctttttaaaaattgcggttatggacccct |
31577474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 350 - 386
Target Start/End: Original strand, 36373701 - 36373737
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaa |
386 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36373701 |
gacttaattgcacttttggacacctatcttttcaaaa |
36373737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 51860638 - 51860586
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| || ||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
51860638 |
ttaattgtacctttagacccctatctttttaaaagttgcggttatggacccct |
51860586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 53764567 - 53764615
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||| |||| ||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
53764567 |
aaaagaaaggcttaattgcacttttggccccctatctttccaaaagttg |
53764615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 338 - 390
Target Start/End: Complemental strand, 54716832 - 54716780
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||| |||| ||||||||||||||||| | |||||||||| |||||||| |
|
|
| T |
54716832 |
taataaaaaaaaggcttaattgcacttttggtcacctatctttttaaaagttg |
54716780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 396
Target Start/End: Original strand, 54717167 - 54717211
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
54717167 |
cttaattgcacttttggacccctaactttccaaaagttgcggtta |
54717211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 352 - 395
Target Start/End: Original strand, 44701817 - 44701860
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtt |
395 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |||| |
|
|
| T |
44701817 |
cttaattgcacttttggccccctatctttccaaaagttgcggtt |
44701860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 405
Target Start/End: Original strand, 21689943 - 21689985
Alignment:
| Q |
363 |
ttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
21689943 |
ttttggacccctatctttccaaaagttgcggttatggccccct |
21689985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 347 - 389
Target Start/End: Original strand, 26012682 - 26012724
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
|||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
26012682 |
aaaggcttaattgcacttttagatccctatcttttcaaaagtt |
26012724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 353 - 391
Target Start/End: Complemental strand, 30632434 - 30632396
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgt |
391 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30632434 |
ttaattgcacttttgatcccctatcttttcaaaagttgt |
30632396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 31869193 - 31869250
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||||||||||| |||||| ||| |||||||| |||||||||||||| |
|
|
| T |
31869193 |
aaaggcttaattgcacttttgga-ccctatttttctaaaagttgcggttatggacccct |
31869250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 386
Target Start/End: Complemental strand, 50725058 - 50725024
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaa |
386 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50725058 |
cttaattgcacttttggccccctatcttttcaaaa |
50725024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 386
Target Start/End: Original strand, 50787792 - 50787826
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaa |
386 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50787792 |
cttaattgcacttttggccccctatcttttcaaaa |
50787826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 14133642 - 14133695
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||| ||||||||||||| ||||| ||| |||||||| ||||| |
|
|
| T |
14133642 |
cttagttgcactttttgacccctatctttccaaaacttgcggttatggccccct |
14133695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 21690180 - 21690127
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
21690180 |
cttaattgcacttttgcccccctatctttccaaaagttacggttatgggcccct |
21690127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 36567186 - 36567133
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||| | |||| |||||||||||||| |||||||| ||||| |
|
|
| T |
36567186 |
cttaattgcatttttggcctcctaacttttcaaaagttgcggttatggccccct |
36567133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 44702178 - 44702125
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||| | ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
44702178 |
cttaattacactttttgccccctatcttttcaaaagttgtgattttggccccct |
44702125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 368 - 405
Target Start/End: Complemental strand, 47360521 - 47360484
Alignment:
| Q |
368 |
gacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
47360521 |
gacccctatctttttaaaagttgcggttatggacccct |
47360484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 398
Target Start/End: Original strand, 49859528 - 49859573
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| ||||||| |
|
|
| T |
49859528 |
ttaattgcacttttggactcctatctttctaaaagttgcggttatg |
49859573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 50033315 - 50033368
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||| ||||||||| |||| |
|
|
| T |
50033315 |
cttaattgcacttttagacctctatctttccaaaagttacggttatggatccct |
50033368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 350 - 390
Target Start/End: Original strand, 23086122 - 23086162
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
23086122 |
gacttaattgcatttttggactcctatctttccaaaagttg |
23086162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 396
Target Start/End: Original strand, 52613344 - 52613388
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
52613344 |
cttaattgcacttttagatttctatcttttcaaaagttgtggtta |
52613388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 53422387 - 53422335
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| ||||||| ||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
53422387 |
ttaattacacttttagacccctatctttctaaaagttgcggttatggatccct |
53422335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 4e-23; HSPs: 180)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 338 - 405
Target Start/End: Complemental strand, 35437539 - 35437472
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
35437539 |
taataaaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35437472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 341 - 405
Target Start/End: Original strand, 3925784 - 3925848
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3925784 |
taaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
3925848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 23909890 - 23909950
Alignment:
| Q |
345 |
ataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23909890 |
ataaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23909950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 342 - 405
Target Start/End: Complemental strand, 3235437 - 3235374
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
3235437 |
aaaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
3235374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 10350798 - 10350861
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10350798 |
aaaaaaaaggcttaattgcatttttggacccctatcttttcaaaagttgtggttatggacccct |
10350861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 34533530 - 34533471
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34533530 |
taaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34533471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 350 - 405
Target Start/End: Complemental strand, 37047979 - 37047924
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37047979 |
gacttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37047924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 931019 - 930966
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
931019 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
930966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 18852497 - 18852550
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18852497 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
18852550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 20387861 - 20387808
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20387861 |
cttaattgcacttttggacccatatcttttcaaaagttgtggttatggacccct |
20387808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 20392335 - 20392282
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20392335 |
cttaattgcacttttggacccatatcttttcaaaagttgtggttatggacccct |
20392282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 344 - 405
Target Start/End: Original strand, 21782597 - 21782658
Alignment:
| Q |
344 |
aataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
21782597 |
aataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
21782658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 21917561 - 21917508
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21917561 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
21917508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 25986927 - 25986980
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25986927 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
25986980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 26612654 - 26612601
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26612654 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26612601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 35121724 - 35121671
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35121724 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35121671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 37452360 - 37452307
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37452360 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37452307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 38445717 - 38445664
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38445717 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
38445664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 44214661 - 44214714
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44214661 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
44214714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 333 - 405
Target Start/End: Complemental strand, 25983321 - 25983249
Alignment:
| Q |
333 |
aaaaataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| || ||||||||| |||||||| |||||||||||||| |
|
|
| T |
25983321 |
aaaaatagtaaaataaaggcttaattgcacttttgggcctctatctttttaaaagttgcggttatggacccct |
25983249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 35711968 - 35711916
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35711968 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35711916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 349 - 405
Target Start/End: Original strand, 35923891 - 35923947
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
35923891 |
agacttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35923947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 10319204 - 10319153
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10319204 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
10319153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 11900046 - 11900105
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11900046 |
taaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11900105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 27512798 - 27512857
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27512798 |
taaaggcttaattgcacttttggacccctatctttacaaaagttgcggttatggacccct |
27512857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 30401225 - 30401166
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
30401225 |
taaaggcttaattgcacttttggactcctatcttttcaaaagttgtggttatggccccct |
30401166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 343 - 405
Target Start/End: Complemental strand, 19194481 - 19194419
Alignment:
| Q |
343 |
aaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
19194481 |
aaataaaggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
19194419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 21782919 - 21782861
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccc-tatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
21782919 |
aagacttaattgcacttttggaccccctatctttccaaaagttgtggttatggacccct |
21782861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 27432487 - 27432545
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27432487 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27432545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 352 - 402
Target Start/End: Complemental strand, 30699335 - 30699285
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30699335 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
30699285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 34533211 - 34533269
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
34533211 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgtggttatgaacccct |
34533269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 36376057 - 36376115
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
36376057 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36376115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 388212 - 388159
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
388212 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
388159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 930710 - 930763
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
930710 |
cttaattacacttttggacccctatcttttcaaaagttgcggttatggacccct |
930763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 5096790 - 5096843
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
5096790 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5096843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 5097096 - 5097043
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5097096 |
cttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
5097043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 7974702 - 7974649
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
7974702 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7974649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 11900361 - 11900308
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11900361 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11900308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 16537079 - 16537132
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
16537079 |
cttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
16537132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 16628583 - 16628530
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
16628583 |
cttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
16628530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 16879237 - 16879290
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16879237 |
cttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
16879290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 18852804 - 18852751
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
18852804 |
cttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
18852751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 23910166 - 23910113
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
23910166 |
cttaattgcacttttggaccactatcttttcaaaagttgcggttatggacccct |
23910113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 24775936 - 24775883
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
24775936 |
cttaattgcacttttggacccctatctctccaaaagttgtggttatggacccct |
24775883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 25982991 - 25983044
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
25982991 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
25983044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 344 - 405
Target Start/End: Original strand, 26612336 - 26612397
Alignment:
| Q |
344 |
aataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
26612336 |
aataaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
26612397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 30757226 - 30757279
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
30757226 |
cttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
30757279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 336 - 405
Target Start/End: Complemental strand, 32555628 - 32555559
Alignment:
| Q |
336 |
aataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
32555628 |
aataataaataaaaggcttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
32555559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 35121415 - 35121468
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
35121415 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
35121468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 37996019 - 37996072
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
37996019 |
cttaattgcacttttggacccctatcttttcaaacgttgcggttatggacccct |
37996072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 38053459 - 38053406
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
38053459 |
cttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
38053406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 337 - 405
Target Start/End: Complemental strand, 38882700 - 38882631
Alignment:
| Q |
337 |
ataataaaataaagacttaattgcacttttggacccctatctttt-caaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
38882700 |
ataataaaaacaaggcttaattgcacttttggacccctatcttttccaaaagttgcggttatggacccct |
38882631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 39753874 - 39753927
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
39753874 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
39753927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 42997058 - 42997111
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
42997058 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42997111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 46622556 - 46622609
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
46622556 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
46622609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 350 - 403
Target Start/End: Complemental strand, 47732016 - 47731963
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
47732016 |
gacttaattgcacttttggacccttatcttttcaaaagttgcggttatggaccc |
47731963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 228268 - 228216
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
228268 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttttggacccct |
228216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 405
Target Start/End: Original strand, 4060979 - 4061043
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||| ||||||||||||||||| |||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
4060979 |
taaaaaaaaaacttaattgcacttttgaacccctatcttttcaaaagttgcggttatgaacccct |
4061043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 18295855 - 18295907
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
18295855 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
18295907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 23740261 - 23740317
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23740261 |
aaaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
23740317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 25987233 - 25987181
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
25987233 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
25987181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 27513117 - 27513061
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
27513117 |
aaaggcttaattgcacttttggacccctatcttttcgaaagttgcggttatggaccc |
27513061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 37047668 - 37047720
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
37047668 |
ttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
37047720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 399
Target Start/End: Complemental strand, 43408520 - 43408468
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43408520 |
aaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
43408468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 497108 - 497167
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
497108 |
taaaggcttaattgcacttttggacccttatcttttcaaaagttgcagttatggacccct |
497167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 10312544 - 10312485
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
10312544 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
10312485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 10318883 - 10318946
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
10318883 |
aaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcagttatgaacccct |
10318946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 17757762 - 17757825
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| ||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
17757762 |
aaaagaaaggcttaattgcacttttagacccctatctttttaaaagttgcggttatggacccct |
17757825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 401
Target Start/End: Complemental strand, 16879554 - 16879500
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
16879554 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
16879500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 353 - 399
Target Start/End: Original strand, 19778277 - 19778323
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19778277 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
19778323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 19778565 - 19778519
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19778565 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
19778519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 20387550 - 20387608
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
20387550 |
aaagacttaattgcacttttggacccttatctttccaaaagttgcagttatggacccct |
20387608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 20392024 - 20392082
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
20392024 |
aaagacttaattgcacttttggacccttatctttccaaaagttgcagttatggacccct |
20392082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 21917083 - 21917141
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||||||||||| |||||| ||||||||||||| |||||||||||||| |
|
|
| T |
21917083 |
aaaggcttaattgcacttttggatccctattttttcaaaagttgcggttatggacccct |
21917141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 34288045 - 34288103
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
34288045 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
34288103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 35711656 - 35711713
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
35711656 |
aaaggcttaattgcacttttggacccctatcttttc-aaagttgcggttatggacccct |
35711713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 35924207 - 35924149
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
35924207 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
35924149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 352 - 402
Target Start/End: Original strand, 39976731 - 39976781
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
39976731 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
39976781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 3926069 - 3926016
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
3926069 |
cttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
3926016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 4061299 - 4061246
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
4061299 |
cttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
4061246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 9035677 - 9035620
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
9035677 |
aagacttaattgcacttttggattcctatctttccaaaagttgcggttatggacccct |
9035620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 9629327 - 9629274
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
9629327 |
cttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
9629274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 10351117 - 10351064
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
10351117 |
cttaattgcacttttggaccccaatcttttcaaaagttacggttatggacccct |
10351064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 18073818 - 18073871
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
18073818 |
cttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
18073871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 18296162 - 18296109
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
18296162 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
18296109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 18363605 - 18363552
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
18363605 |
cttaattgcacttttggacccctatctttgcaaaagttgcggttatggatccct |
18363552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 19194162 - 19194215
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
19194162 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatagacccct |
19194215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 30140922 - 30140975
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
30140922 |
cttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
30140975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 30141231 - 30141178
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
30141231 |
cttaattgcacttttggacccctatctttgcaaaagttgcggttatagacccct |
30141178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 34288362 - 34288309
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
34288362 |
cttaattgcacttttgaacccctatctttttaaaagttgcggttatggacccct |
34288309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 35437208 - 35437261
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
35437208 |
cttaattgcacatttggacccctatctttccaaaagttgcggttatggacccct |
35437261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 38879163 - 38879216
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
38879163 |
cttaattgtacttttggacctctatcttttcaaaagttgcggttatggacccct |
38879216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 45231524 - 45231577
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
45231524 |
cttaattgcacttttggacccctatcttttcaaaagttacggttatggatccct |
45231577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 47731704 - 47731757
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
47731704 |
cttaattgcacttttggacccctatcttttaaaaaattgcggttatggacccct |
47731757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 353 - 402
Target Start/End: Complemental strand, 48871398 - 48871349
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
48871398 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
48871349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 227960 - 228012
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
227960 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
228012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 402
Target Start/End: Original strand, 30028386 - 30028446
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
30028386 |
aaaaaaaagacttaattgcactttaggacccctatctttctaaaagttgcggttatggacc |
30028446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 30028693 - 30028641
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||| |||| |
|
|
| T |
30028693 |
ttaattgcacttttggactcttatcttttcaaaagttgtggttatggatccct |
30028641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 30757534 - 30757482
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
30757534 |
ttaattgcacttttggacccctatttttttaaaagttgcggttatggacccct |
30757482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 36376372 - 36376320
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
36376372 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggaaccct |
36376320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 38445407 - 38445459
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
38445407 |
ttaattgcacttttggatccctatctttcaaaaagttgtggttatggacccct |
38445459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 45231830 - 45231778
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
45231830 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
45231778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 399
Target Start/End: Complemental strand, 19233630 - 19233583
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
19233630 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
19233583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 30699015 - 30699078
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||| |||||||||||||||||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
30699015 |
aaaattaaggcttaattgcacttttggatccctatctttccaaaagttgcagttatggacccct |
30699078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 336 - 399
Target Start/End: Original strand, 43632327 - 43632390
Alignment:
| Q |
336 |
aataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||| | |||||| ||||||||||||||||||||||||||||| ||||| ||| |||||||| |
|
|
| T |
43632327 |
aataattacataaaggcttaattgcacttttggacccctatctttccaaaaattgcggttatgg |
43632390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 399
Target Start/End: Original strand, 44189407 - 44189454
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
44189407 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
44189454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 398
Target Start/End: Original strand, 3931648 - 3931694
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
3931648 |
cttaattgcacttttggacctctatcttttcaaaagttggggttatg |
3931694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 7974386 - 7974444
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
7974386 |
aaaggcttaattgcacttttgaacccctatttttccaaaagttgcggttatggacccct |
7974444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 402
Target Start/End: Original strand, 9035360 - 9035410
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
9035360 |
cttaattgcaattttggacccctatctttttaaaagttgcggttatggacc |
9035410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 344 - 390
Target Start/End: Original strand, 11742704 - 11742750
Alignment:
| Q |
344 |
aataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
11742704 |
aataaagacttaattgcacttttggccccctatctttttaaaagttg |
11742750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 18074131 - 18074073
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
18074131 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatggatccct |
18074073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 25036344 - 25036298
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
25036344 |
cttaattgcacttttggatccctatctttttaaaagttgtggttatg |
25036298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 402
Target Start/End: Original strand, 38053148 - 38053198
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| || |||||||||||| |
|
|
| T |
38053148 |
cttaattgcacttttggacccctatctttccaaaaattttggttatggacc |
38053198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 353 - 399
Target Start/End: Complemental strand, 44189694 - 44189648
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
44189694 |
ttaattgcacttctggacccctatcttttcaaaagttgcggttatgg |
44189648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 348 - 390
Target Start/End: Complemental strand, 45480144 - 45480102
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45480144 |
aagacttaattgcacttttggccccctatcttttcaaaagttg |
45480102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 10985996 - 10986049
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||| |||||||||||||| |||| |||||||||||||||||| |||||||| |
|
|
| T |
10985996 |
taaagatttaattgcacttttagacctctatcttttcaaaagttgcggttatgg |
10986049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 11275476 - 11275423
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
11275476 |
cttaattacacctttggacccctatcttttcaaaagttgcggttatggccccct |
11275423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 401
Target Start/End: Complemental strand, 16537388 - 16537339
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
16537388 |
cttaattgcacttttggacccctgtctttcgaaaagttgtggttatggac |
16537339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 401
Target Start/End: Original strand, 16628274 - 16628323
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
16628274 |
cttaattgcacttttggacccctgtctttcgaaaagttgtggttatggac |
16628323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 18363297 - 18363350
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| | |||||||||||| |
|
|
| T |
18363297 |
cttaattgcacttttggacccctatgtttccaaaagttgcgattatggacccct |
18363350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 19233342 - 19233395
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
19233342 |
cttaattgcacttttggaaccctatctttccaaaagttgcggttatggccccct |
19233395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 23740576 - 23740523
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
23740576 |
cttaattgtacttttggacccctatctttcgaaaagttgcggttatggacccct |
23740523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 25036034 - 25036087
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| ||||||||| |||| |
|
|
| T |
25036034 |
cttaattgcactttttgacccctatattttcaaaagttgcggttatggatccct |
25036087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 34404445 - 34404498
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
34404445 |
cttaattgcacttttagacccctatctttccaaaaattgcggttatggacccct |
34404498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 38879461 - 38879408
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| || |||||| |||| |
|
|
| T |
38879461 |
cttaattgcacttttggacccctatctttccaaaagttgcggctatggatccct |
38879408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 38882372 - 38882425
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
38882372 |
cttaattgcatttttgtacccctatcttttcaaaagttgcggttatgaacccct |
38882425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 347 - 392
Target Start/End: Complemental strand, 39142506 - 39142461
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtg |
392 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39142506 |
aaaggcttaattgcacttttggtcccctatcttttcaaaagttgtg |
39142461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 397
Target Start/End: Complemental strand, 42997363 - 42997318
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
42997363 |
cttaattgcatttttggacccctatcttttcaaaagttgcggttat |
42997318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 5181741 - 5181689
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
5181741 |
ttaattgcacttttagacccctatcttttcaaaaattgcagttatggacccct |
5181689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 7195459 - 7195511
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
7195459 |
ttaattgcatttttggacccctatcttttcaaaagttgcagttatggatccct |
7195511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 350 - 402
Target Start/End: Complemental strand, 29673763 - 29673711
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||| || |||||| |
|
|
| T |
29673763 |
gacttaattgcacctttggccccctatcttttcaaaagttgtgattttggacc |
29673711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 357 - 405
Target Start/End: Complemental strand, 39754180 - 39754132
Alignment:
| Q |
357 |
ttgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
39754180 |
ttgcatttttggacccctatctttccaaaagttgcggttatggacccct |
39754132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 352 - 399
Target Start/End: Complemental strand, 10356409 - 10356362
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
10356409 |
cttaattgcacttttggacccctatatttccaaaagttgcggttatgg |
10356362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 396
Target Start/End: Original strand, 30085612 - 30085667
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
30085612 |
taaaagaaaggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
30085667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 34404752 - 34404693
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||| |||||||||| |||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
34404752 |
taaaggcttaagtgcacttttgaacccttatctttccaaaagttgcggttatggacccct |
34404693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 353 - 392
Target Start/End: Complemental strand, 36801911 - 36801872
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtg |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36801911 |
ttaattgcacttttggccccctatcttttcaaaagttgtg |
36801872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 347 - 398
Target Start/End: Original strand, 40436033 - 40436084
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
40436033 |
aaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
40436084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 10385760 - 10385722
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10385760 |
cttaattgcacttttggacccctatctttccaaaagttg |
10385722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 353 - 399
Target Start/End: Original strand, 11275190 - 11275236
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
11275190 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatgg |
11275236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 11742969 - 11742931
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11742969 |
cttaattgcacttttggccccctatcttttcaaaagttg |
11742931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 344 - 390
Target Start/End: Complemental strand, 18201703 - 18201657
Alignment:
| Q |
344 |
aataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||| ||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
18201703 |
aataaaggcttaattgcacttttggccccctgtcttttcaaaagttg |
18201657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 348 - 398
Target Start/End: Original strand, 18798028 - 18798078
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
18798028 |
aagatttaattgcacttttggacccctatctttctaaaagttgcggttatg |
18798078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 26872671 - 26872625
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
26872671 |
cttaattccacttttggacccttatcttttcaaaagttgcggttatg |
26872625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 37452048 - 37452106
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||| || || ||||||||||||||||| ||||||||| |||| |
|
|
| T |
37452048 |
aaaggcttaattgcacttttagatccatatcttttcaaaagttgcggttatggatccct |
37452106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 353 - 399
Target Start/End: Complemental strand, 49081643 - 49081597
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
49081643 |
ttaattgcacttttagatccctatcttttcaaaagttgcggttatgg |
49081597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 353 - 398
Target Start/End: Complemental strand, 3931804 - 3931759
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
3931804 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatg |
3931759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 9629014 - 9629067
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||| |||||||||| |||||||| ||||||||| |||| |
|
|
| T |
9629014 |
cttaattacacttttggactcctatctttttaaaagttgcggttatggaaccct |
9629067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 11578367 - 11578314
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||| |||| ||||||||| |||| |
|
|
| T |
11578367 |
cttaattgtacttttggacccctatctttccaaaggttgcggttatggatccct |
11578314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 353 - 402
Target Start/End: Complemental strand, 23359004 - 23358955
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
23359004 |
ttaattgcatttttggacccctatctttctaaaagttgttgttatggacc |
23358955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 389
Target Start/End: Complemental strand, 25683986 - 25683949
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25683986 |
cttaattgcacttttggacccctatctttccaaaagtt |
25683949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 353 - 390
Target Start/End: Complemental strand, 36204492 - 36204455
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36204492 |
ttaattgcacttttggccccctatcttttcaaaagttg |
36204455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 37996322 - 37996269
Alignment:
| Q |
353 |
ttaattgcacttttgga-cccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
37996322 |
ttaattgcatttttggatcccctatctttccaaaagttgcggttatggacccct |
37996269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 42751253 - 42751200
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||| |||| |||||||| ||||||| |||||| |
|
|
| T |
42751253 |
cttaattgcacttttggacccttatttttttaaaagttgcggttatgaacccct |
42751200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 46622864 - 46622811
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
46622864 |
cttaattgcacttttcaacccctatctttccaaaggttgcggttatggacccct |
46622811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 396
Target Start/End: Original strand, 10715840 - 10715884
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
10715840 |
cttaattgcacttttggacccctaactttccaaaagttgcggtta |
10715884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 11578058 - 11578110
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
11578058 |
ttaattgtacttttggacccctatcattcaaaaagttgcggttatggacccct |
11578110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 397
Target Start/End: Complemental strand, 18798320 - 18798276
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
18798320 |
ttaattgcacttttggatccctatctttccaaaagttgcggttat |
18798276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 350 - 390
Target Start/End: Complemental strand, 20588468 - 20588428
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
20588468 |
gacttaattgcacttttggccctctatcttttcaaaagttg |
20588428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 396
Target Start/End: Complemental strand, 30086614 - 30086570
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
30086614 |
cttaattgcacttttggacccctaactttccaaaagttgcggtta |
30086570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 400
Target Start/End: Original strand, 42750945 - 42750993
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
||||||| ||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
42750945 |
cttaattatacttttggatccctattttttcaaaagttgtggttatgga |
42750993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 352 - 399
Target Start/End: Original strand, 16705458 - 16705505
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| |||||||||||| |
|
|
| T |
16705458 |
cttaattgcacttttggacctttatctttttaaaaattgtggttatgg |
16705505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 350 - 397
Target Start/End: Complemental strand, 16705749 - 16705702
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
16705749 |
gacttaattgcatttttggacctttatcttttcaaaagttgcggttat |
16705702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 347 - 390
Target Start/End: Original strand, 17167852 - 17167894
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17167852 |
aaaggcttaattgcacttttgg-cccctatcttttcaaaagttg |
17167894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 352 - 399
Target Start/End: Original strand, 17679694 - 17679741
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| |||||||||||| |
|
|
| T |
17679694 |
cttaattgcacttttggacctttatctttttaaaaattgtggttatgg |
17679741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 350 - 397
Target Start/End: Complemental strand, 17679985 - 17679938
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
17679985 |
gacttaattgcatttttggacctttatcttttcaaaagttgcggttat |
17679938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 352 - 391
Target Start/End: Complemental strand, 37858363 - 37858325
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgt |
391 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37858363 |
cttaattgcacttttg-acccctatcttttcaaaagttgt |
37858325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 353 - 392
Target Start/End: Original strand, 38974413 - 38974452
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtg |
392 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
38974413 |
ttaattgcatttttggccccctatcttttcaaaagttgtg |
38974452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 352 - 399
Target Start/End: Original strand, 43408226 - 43408273
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||| |||||||||||| |||||||| ||||||||| |||||||| |
|
|
| T |
43408226 |
cttaatttcacttttggacctctatctttccaaaagttgcggttatgg |
43408273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 17802218 - 17802181
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17802218 |
cttaattgcacttttg-acccctatcttttcaaaagttg |
17802181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 29163102 - 29163140
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
29163102 |
cttaattgcactttttgccccctatcttttcaaaagttg |
29163140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 31530430 - 31530392
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
31530430 |
cttaattgcacttttggccccctatctttccaaaagttg |
31530392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 41445975 - 41446013
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41445975 |
cttaattgcacttttggctccctatcttttcaaaagttg |
41446013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 45863025 - 45863062
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45863025 |
cttaattgcacttttg-acccctatcttttcaaaagttg |
45863062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 17758073 - 17758021
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||| || |||||||||| |||| |
|
|
| T |
17758073 |
cttaattgcacttttggacctctatctttccaaaa-ttatggttatggatccct |
17758021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 390
Target Start/End: Complemental strand, 21202912 - 21202875
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
21202912 |
ttaattgcacttttggccccctatctttccaaaagttg |
21202875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 364 - 405
Target Start/End: Original strand, 24236128 - 24236169
Alignment:
| Q |
364 |
tttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
24236128 |
tttggccccctatctttccaaaagttgcggttatggacccct |
24236169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 24236419 - 24236366
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||||| |||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
24236419 |
cttaattgcatttttgcacccgtatctttctaaaagttgcggttatggacccct |
24236366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 390
Target Start/End: Original strand, 48925914 - 48925951
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
48925914 |
ttaattgcactttttgtcccctatcttttcaaaagttg |
48925951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 346 - 390
Target Start/End: Original strand, 40139525 - 40139569
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
40139525 |
taaaggcttaattgcacttttgggcccctatctttctaaaagttg |
40139569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 392
Target Start/End: Complemental strand, 47259368 - 47259328
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtg |
392 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
47259368 |
cttaattgcacttttggccctatatcttttcaaaagttgtg |
47259328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 4e-23; HSPs: 121)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 31740761 - 31740824
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31740761 |
aaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
31740824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 2100692 - 2100639
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2100692 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
2100639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 1814978 - 1815031
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1814978 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1815031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 348 - 405
Target Start/End: Original strand, 3195714 - 3195771
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
3195714 |
aagacttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
3195771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 10977660 - 10977713
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10977660 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
10977713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 11322336 - 11322283
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11322336 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11322283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 18683014 - 18683067
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18683014 |
cttaattgcacttttggacctctatcttttcaaaagttgtggttatggacccct |
18683067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 27223620 - 27223567
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27223620 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
27223567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 9703854 - 9703802
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9703854 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
9703802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 345 - 400
Target Start/End: Complemental strand, 2565397 - 2565342
Alignment:
| Q |
345 |
ataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2565397 |
ataaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgga |
2565342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 354 - 405
Target Start/End: Original strand, 12256768 - 12256819
Alignment:
| Q |
354 |
taattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12256768 |
taattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
12256819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 2565075 - 2565133
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
2565075 |
aaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
2565133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 5606613 - 5606555
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
5606613 |
aaaggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
5606555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 3185468 - 3185415
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3185468 |
cttaattgcacttttggtcccctatcttttcaaaagttgcggttatggacccct |
3185415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 4405552 - 4405499
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
4405552 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
4405499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 5606298 - 5606351
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
5606298 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
5606351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 6261383 - 6261436
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
6261383 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6261436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 6261688 - 6261635
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
6261688 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6261635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 7391487 - 7391540
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
7391487 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7391540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 11213494 - 11213441
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11213494 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11213441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 11321904 - 11321957
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
11321904 |
cttaattgcacttttggacccctatttttttaaaagttgtggttatggacccct |
11321957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 11746290 - 11746237
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
11746290 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggccccct |
11746237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 13042410 - 13042463
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
13042410 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
13042463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 23291258 - 23291311
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23291258 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23291311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 23883091 - 23883144
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
23883091 |
cttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
23883144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 29696850 - 29696903
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29696850 |
cttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
29696903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 30965693 - 30965746
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30965693 |
cttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
30965746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 340 - 405
Target Start/End: Complemental strand, 30966015 - 30965950
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
30966015 |
ataaaaaaaaggcttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
30965950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 3535089 - 3535037
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
3535089 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggccccct |
3535037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 11445979 - 11446031
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
11445979 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
11446031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 15150038 - 15149986
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15150038 |
ttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
15149986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 15273289 - 15273237
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
15273289 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggccccct |
15273237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 345 - 405
Target Start/End: Complemental strand, 15711954 - 15711894
Alignment:
| Q |
345 |
ataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
15711954 |
ataaaggcttaattgcacttttcgacccctatctttttaaaagttgcggttatggacccct |
15711894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 17965842 - 17965894
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
17965842 |
ttaattgcacttttggatccctatcttttcaaaagttggggttatggacccct |
17965894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 27765261 - 27765313
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27765261 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27765313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 340 - 404
Target Start/End: Original strand, 31951195 - 31951259
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
31951195 |
ataaaataaaggtttaattgcatttttggacccctatctttttaaaagttgcggttatggacccc |
31951259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 3196023 - 3195972
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
3196023 |
cttaattgcacttttggatccttatcttttcaaaagttgtggttatggaccc |
3195972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 10893881 - 10893944
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
10893881 |
aaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
10893944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 338 - 405
Target Start/End: Original strand, 14996997 - 14997064
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| ||| || |||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
14996997 |
taataatatataggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
14997064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 28930466 - 28930517
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
28930466 |
cttaattgcacttttggacctctatcttttcaaaagttgcggttatggaccc |
28930517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 28930775 - 28930724
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
28930775 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatcgaccc |
28930724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 342 - 405
Target Start/End: Complemental strand, 31833587 - 31833524
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
31833587 |
aaaaaaaaggcttaattgcacttttggacccctatctttccaaaaattgcggttatggacccct |
31833524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 1815292 - 1815234
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
1815292 |
aaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
1815234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 3534795 - 3534853
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
3534795 |
aaagacttaattacacttttggacccctatctttccaaaagttgcggttatggtcccct |
3534853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 353 - 403
Target Start/End: Complemental strand, 10977968 - 10977918
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10977968 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
10977918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 351 - 405
Target Start/End: Complemental strand, 31741083 - 31741029
Alignment:
| Q |
351 |
acttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
31741083 |
acttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
31741029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 352 - 398
Target Start/End: Original strand, 31833268 - 31833314
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31833268 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
31833314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 7391788 - 7391735
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
7391788 |
cttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
7391735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 11277616 - 11277673
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
||||||| ||| |||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
11277616 |
ataaaattaaggcttaattgcatttttggacccctatcttttcaaaagttgcggttat |
11277673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 11614900 - 11614953
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
11614900 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
11614953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 11746000 - 11746053
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
11746000 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggtcccct |
11746053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 13042719 - 13042666
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
13042719 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
13042666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 14997320 - 14997267
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
14997320 |
cttaattgcacttttggacccctatctttgcaaaagttgcggttatagacccct |
14997267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 401
Target Start/End: Original strand, 15149729 - 15149778
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
15149729 |
cttaattgcacttttggactcctatcttttcaaaagttgcggttatggac |
15149778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 15272994 - 15273047
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
15272994 |
taaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
15273047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 20080120 - 20080173
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
20080120 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
20080173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 22279501 - 22279554
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22279501 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
22279554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 23883399 - 23883346
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
23883399 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
23883346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 25749957 - 25750010
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
25749957 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
25750010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 26716682 - 26716629
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
26716682 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
26716629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 29697154 - 29697101
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
29697154 |
cttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
29697101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 356 - 401
Target Start/End: Original strand, 30818224 - 30818269
Alignment:
| Q |
356 |
attgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30818224 |
attgcacttttggacccctatcttttcaaaagttgcggttatggac |
30818269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 30818526 - 30818473
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
30818526 |
cttaattgcacttttgaatccctatcttttcaaaagttgcggttatggacccct |
30818473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 401
Target Start/End: Complemental strand, 31951512 - 31951463
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
31951512 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
31951463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 346 - 394
Target Start/End: Complemental strand, 23585295 - 23585247
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggt |
394 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23585295 |
taaaggcttaattgcacttttggacccctatctttccaaaagttgtggt |
23585247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 16735876 - 16735825
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| |||||||||||| |
|
|
| T |
16735876 |
cttaattgcacttttggacccctatttttccaaaagttgcggttatggaccc |
16735825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 389
Target Start/End: Original strand, 33274224 - 33274271
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33274224 |
aaaataaaggcttaattgcacttttggccccctatcttttcaaaagtt |
33274271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 397
Target Start/End: Original strand, 1896895 - 1896945
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
1896895 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttat |
1896945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 353 - 403
Target Start/End: Complemental strand, 11277927 - 11277877
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
11277927 |
ttaattgtacttttggacccctatcttttcaaaagttgcggttatgaaccc |
11277877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 28563636 - 28563578
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
28563636 |
aaaggcttaattgcacttttggacctctatctttcaaaaagttgcggttatggacccct |
28563578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 30239520 - 30239462
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
30239520 |
aaaggcttaattgcacttttagacccctatctttccaaaagttgcagttatggacccct |
30239462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 402
Target Start/End: Complemental strand, 34705687 - 34705637
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
34705687 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggacc |
34705637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 10894181 - 10894128
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |||||||| ||||| |
|
|
| T |
10894181 |
cttaattgcacttttggacctctatctttccaaaagttgcggttatggccccct |
10894128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 11615210 - 11615157
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
11615210 |
cttaattgcacttttgggtccctatctttttaaaagttgcggttatggacccct |
11615157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 12257075 - 12257022
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
12257075 |
cttaattgcacttttggacctttatctttccaaaagttgcggttatggacccct |
12257022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 15711637 - 15711690
Alignment:
| Q |
353 |
ttaattgcacttttggacc-cctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||| |||| |
|
|
| T |
15711637 |
ttaattgcacttttggacctcctatcttttcaaaagttgcggttatggatccct |
15711690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 16765043 - 16765096
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
16765043 |
cttaattgtacttttggacccctatctttccaaaagttgcggttatgcacccct |
16765096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 16765348 - 16765296
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
16765348 |
cttaattgcacttttggacccctatctttac-aaagttgaggttatggacccct |
16765296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 18683321 - 18683268
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
18683321 |
cttaatttcacttttggacccctatttttccaaaagttgcggttatggacccct |
18683268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 20630354 - 20630407
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
20630354 |
cttaattgcacttatggacccctatctttccaaaagttgcggttatagacccct |
20630407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 20630660 - 20630607
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
20630660 |
cttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20630607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 21003370 - 21003423
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||| ||||| |||||||| |
|
|
| T |
21003370 |
cttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
21003423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 27771525 - 27771472
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
27771525 |
cttaattacacttttggacccttatctttttaaaagttgcggttatggacccct |
27771472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 28563329 - 28563382
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
28563329 |
cttaattgcacttttggacccctacctttctaaaagttgcggttatggacccct |
28563382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 342 - 403
Target Start/End: Original strand, 34705368 - 34705429
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||| |||| |||||||||| |||||||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
34705368 |
aaaaaaaaggcttaattgcatttttggacccctatattttcaaaagttgcggttctggaccc |
34705429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 343 - 403
Target Start/End: Complemental strand, 10255840 - 10255780
Alignment:
| Q |
343 |
aaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||| ||||| ||||| |
|
|
| T |
10255840 |
aaataaaggtttaattgcacttttggacccctatctttttaaaagttgcagttatagaccc |
10255780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 401
Target Start/End: Complemental strand, 22279808 - 22279760
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||| |||||||||| |
|
|
| T |
22279808 |
ttaattgcacttttgaacccctatcttttcaaaaattgcggttatggac |
22279760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 398
Target Start/End: Original strand, 2100382 - 2100428
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| ||||||| |
|
|
| T |
2100382 |
cttaattgcacttttggacctctatctttccaaaagttgcggttatg |
2100428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 4037040 - 4037078
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4037040 |
cttaattgcacttttggccccctatcttttcaaaagttg |
4037078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 6324204 - 6324242
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6324204 |
cttaattgcacttttggccccctatcttttcaaaagttg |
6324242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 402
Target Start/End: Complemental strand, 26171518 - 26171468
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||| | ||||||||| |
|
|
| T |
26171518 |
cttaattgcacttttggacccctatctttccaaaacttgcgattatggacc |
26171468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 13440187 - 13440134
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| | ||||||| ||||||||| ||||| |||||||| |
|
|
| T |
13440187 |
cttaattgcacttttggactcttatctttccaaaagttgcggttacggacccct |
13440134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 20080410 - 20080357
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
20080410 |
cttaattgtacttttggacccctatctttgtaaaagttgcggttatggccccct |
20080357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 21008729 - 21008782
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
21008729 |
cttaattgcatttttagacctttatcttttcaaaagttgtggttatgaacccct |
21008782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 397
Target Start/End: Original strand, 7324658 - 7324702
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||| |||||| |
|
|
| T |
7324658 |
ttaattgcatttttggatccctatcttttcaaaagttgcggttat |
7324702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 388
Target Start/End: Complemental strand, 9126686 - 9126650
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagt |
388 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9126686 |
cttaattgcacttttggacccctatctttccaaaagt |
9126650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 348 - 392
Target Start/End: Original strand, 12730305 - 12730349
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccctatcttttcaaaagttgtg |
392 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
12730305 |
aagacttaattgcacttttggcctcttatcttttcaaaagttgtg |
12730349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 13439880 - 13439932
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| || ||||||||| ||||||||| | |||||||||||| |
|
|
| T |
13439880 |
ttaattgcacttttgaactcctatctttccaaaagttgcgtttatggacccct |
13439932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 346 - 390
Target Start/End: Original strand, 14168572 - 14168616
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||| ||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
14168572 |
taaaggcttaattgcacttttggccctctatcttttcaaaagttg |
14168616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 350 - 390
Target Start/End: Complemental strand, 23350233 - 23350193
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
23350233 |
gacttaattgcacttttggccccttatcttttcaaaagttg |
23350193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 396
Target Start/End: Original strand, 28931951 - 28931995
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
28931951 |
cttaattgcacttttggacccctaactttccaaaagttgcggtta |
28931995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 396
Target Start/End: Complemental strand, 28932948 - 28932904
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
28932948 |
cttaattgcacttttggacccctaactttccaaaagttgcggtta |
28932904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 28960220 - 28960268
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||| |||||||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
28960220 |
aaaataaaggcttaattgtacttttggccccctatctttccaaaagttg |
28960268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 355 - 398
Target Start/End: Original strand, 3185238 - 3185281
Alignment:
| Q |
355 |
aattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||| ||||||| |
|
|
| T |
3185238 |
aattgcactttaggacccctatctttccaaaagttgaggttatg |
3185281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 346 - 389
Target Start/End: Original strand, 9951883 - 9951926
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
||||| ||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
9951883 |
taaaggcttaattgcacttttggccacctatcttttcaaaagtt |
9951926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 347 - 386
Target Start/End: Complemental strand, 14169034 - 14168995
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaa |
386 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14169034 |
aaaggcttaattgcacttttggccccctatcttttcaaaa |
14168995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 343 - 390
Target Start/End: Original strand, 32591589 - 32591636
Alignment:
| Q |
343 |
aaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32591589 |
aaataaatgcttaattgcacttttggcaccctatcttttcaaaagttg |
32591636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 1897190 - 1897144
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||| ||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
1897190 |
cttaattgcatttttgaacccctatctttccaaaagttgcggttatg |
1897144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 8160601 - 8160639
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8160601 |
cttaattgcacttttgatcccctatcttttcaaaagttg |
8160639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 11307387 - 11307349
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
11307387 |
cttaattgcacttttggcctcctatcttttcaaaagttg |
11307349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 371 - 405
Target Start/End: Original strand, 11322043 - 11322077
Alignment:
| Q |
371 |
ccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
11322043 |
ccctatcttttcaaaagttgcggttatggacccct |
11322077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 12730647 - 12730609
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
12730647 |
cttaattgcacttttggcctcctatcttttcaaaagttg |
12730609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 24418488 - 24418526
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
24418488 |
cttaattgcacttttggcctcctatcttttcaaaagttg |
24418526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 32591914 - 32591876
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32591914 |
cttaattgcacttttgaccccctatcttttcaaaagttg |
32591876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 349 - 386
Target Start/End: Original strand, 1358532 - 1358568
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaa |
386 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1358532 |
agacttaattgcacttttgga-ccctatcttttcaaaa |
1358568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 398
Target Start/End: Complemental strand, 9067742 - 9067697
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||| ||||||| |
|
|
| T |
9067742 |
ttaattgcacttttggattcttatcttttcaaaagttgcggttatg |
9067697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 400
Target Start/End: Complemental strand, 3194747 - 3194699
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
||||||||||||||||||| | ||||||| |||||||| ||||||||| |
|
|
| T |
3194747 |
cttaattgcacttttggactcatatctttctaaaagttgcggttatgga |
3194699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 392
Target Start/End: Complemental strand, 11109045 - 11109005
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtg |
392 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
11109045 |
cttaattgcacttttgaccccttatcttttcaaaagttgtg |
11109005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 392
Target Start/End: Complemental strand, 21009054 - 21009014
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtg |
392 |
Q |
| |
|
||||||| |||||||||||| |||||||| ||||||||||| |
|
|
| T |
21009054 |
cttaattacacttttggacctctatctttccaaaagttgtg |
21009014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 353 - 389
Target Start/End: Original strand, 33129405 - 33129440
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33129405 |
ttaattgcacttttgg-cccctatcttttcaaaagtt |
33129440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 33265078 - 33265126
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
33265078 |
aaaataaaggtttaattgcacttttggccccctatctttctaaaagttg |
33265126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 2e-22; HSPs: 184)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 339 - 405
Target Start/End: Original strand, 28620028 - 28620094
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28620028 |
aataaaattaaggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
28620094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 25631088 - 25631141
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25631088 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
25631141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 340 - 405
Target Start/End: Original strand, 40687656 - 40687721
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40687656 |
ataaaattaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40687721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 337 - 405
Target Start/End: Complemental strand, 3223610 - 3223542
Alignment:
| Q |
337 |
ataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
3223610 |
ataataaaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
3223542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 341 - 405
Target Start/End: Original strand, 12049110 - 12049174
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12049110 |
taaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
12049174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 349 - 405
Target Start/End: Complemental strand, 16329893 - 16329837
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16329893 |
agacttaattgcacttttggatccctatcttttcaaaagttgtggttatggacccct |
16329837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 341 - 405
Target Start/End: Original strand, 16521145 - 16521209
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
16521145 |
taaaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
16521209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 341 - 405
Target Start/End: Original strand, 20974451 - 20974515
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20974451 |
taaaaaaaagacttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20974515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 341 - 405
Target Start/End: Complemental strand, 34606692 - 34606628
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34606692 |
taaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34606628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 341 - 405
Target Start/End: Complemental strand, 35307024 - 35306960
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35307024 |
taaattaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35306960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 349 - 405
Target Start/End: Original strand, 40767887 - 40767943
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40767887 |
agacttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40767943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 23263137 - 23263200
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23263137 |
aaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23263200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 339 - 401
Target Start/End: Complemental strand, 16666897 - 16666835
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
16666897 |
aataaaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
16666835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 2710648 - 2710595
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2710648 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
2710595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 3020905 - 3020852
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3020905 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
3020852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 8339961 - 8340014
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8339961 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
8340014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 20974720 - 20974667
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20974720 |
cttaattgtacttttggacccctatcttttcaaaagttgtggttatggacccct |
20974667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 26323686 - 26323633
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26323686 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26323633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 34169099 - 34169046
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34169099 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34169046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 34734384 - 34734331
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34734384 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34734331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 341 - 405
Target Start/End: Original strand, 4125435 - 4125499
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
4125435 |
taaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
4125499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 8755323 - 8755271
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8755323 |
ttaattgcacttttggacccctattttttcaaaagttgtggttatggacccct |
8755271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 26151797 - 26151849
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26151797 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26151849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 343 - 403
Target Start/End: Complemental strand, 34082421 - 34082361
Alignment:
| Q |
343 |
aaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
34082421 |
aaataaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgcaccc |
34082361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 14647688 - 14647751
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
14647688 |
aaaaaaaaggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
14647751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 342 - 405
Target Start/End: Complemental strand, 15738394 - 15738331
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
15738394 |
aaaaaaaaggcttaattgcacttttggacccatatcttttcaaaagttgcggttatggacccct |
15738331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 350 - 405
Target Start/End: Complemental strand, 28395246 - 28395191
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
28395246 |
gacttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28395191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 342 - 405
Target Start/End: Complemental strand, 28736761 - 28736698
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| ||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28736761 |
aaaaaaaaggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
28736698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 338 - 405
Target Start/End: Original strand, 40297653 - 40297720
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
40297653 |
taataaaatgtaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
40297720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 42739523 - 42739582
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42739523 |
taaaggcttaattgtacttttgaacccctatcttttcaaaagttgtggttatggacccct |
42739582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 339 - 405
Target Start/End: Original strand, 3020583 - 3020649
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| || || ||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
3020583 |
aataaactataggcttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
3020649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 339 - 405
Target Start/End: Complemental strand, 7623844 - 7623778
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| |||| ||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7623844 |
aataaaaaaaaggtttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
7623778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 30894432 - 30894374
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30894432 |
aaaggcttaattgcatttttggatccctatcttttcaaaagttgtggttatggacccct |
30894374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 223205 - 223152
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
223205 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
223152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 353 - 402
Target Start/End: Original strand, 1055374 - 1055423
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1055374 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
1055423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 2710342 - 2710395
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
2710342 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
2710395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 5088383 - 5088330
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
5088383 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5088330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 11480038 - 11480091
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11480038 |
cttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
11480091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 13765261 - 13765314
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13765261 |
cttaattgcacttttcgacccctatcttttcaaaagttgcggttatggacccct |
13765314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 15526706 - 15526759
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
15526706 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
15526759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 16666075 - 16666128
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
16666075 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
16666128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 22773896 - 22773843
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
22773896 |
cttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
22773843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 27264111 - 27264164
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27264111 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27264164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 28394935 - 28394988
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
28394935 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28394988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 29401090 - 29401143
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29401090 |
gacttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
29401143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 29401400 - 29401347
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
29401400 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29401347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 31172875 - 31172822
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
31172875 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
31172822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 31455884 - 31455937
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
31455884 |
cttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
31455937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 31456172 - 31456119
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
31456172 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
31456119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 40687980 - 40687927
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40687980 |
cttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
40687927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 40768199 - 40768146
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
40768199 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
40768146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 41880348 - 41880295
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
41880348 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41880295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 8755016 - 8755068
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
8755016 |
ttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
8755068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 16597044 - 16597096
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
16597044 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
16597096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 16859961 - 16860013
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
16859961 |
ttaattgcacttttggacccctatctttttaaaagttgtggttatggccccct |
16860013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 27264415 - 27264363
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27264415 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27264363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 29183136 - 29183188
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
29183136 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29183188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 34082102 - 34082154
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
34082102 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
34082154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 7219500 - 7219551
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
7219500 |
cttaattgcacttttggacccctattttttcaaaagttgcggttatggaccc |
7219551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 338 - 405
Target Start/End: Complemental strand, 13170205 - 13170138
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
13170205 |
taataaattaaaggcttaattgcacttttggacccttatctttctaaaagttgcggttatggacccct |
13170138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 353 - 404
Target Start/End: Complemental strand, 25566852 - 25566801
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
25566852 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccc |
25566801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 399
Target Start/End: Original strand, 26036237 - 26036284
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26036237 |
cttaattgcacttttggacccatatcttttcaaaagttgtggttatgg |
26036284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 26323367 - 26323430
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||| ||||||||| |||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
26323367 |
aaaaaaaagacttatttgcactttgggacccctatctttccaaaagttggggttatggacccct |
26323430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 30894127 - 30894178
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
30894127 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
30894178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 33825596 - 33825655
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
33825596 |
taaagatttaattgcacgtttggacccctatctttccaaaagttgcggttatggacccct |
33825655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 348 - 398
Target Start/End: Original strand, 23499964 - 23500014
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23499964 |
aagactaaattgcacttttggacccctatcttttcaaaagttgcggttatg |
23500014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 28251395 - 28251453
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
28251395 |
aaagtcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
28251453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 4125755 - 4125702
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
4125755 |
cttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
4125702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 5088076 - 5088129
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
5088076 |
cttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
5088129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 8340276 - 8340219
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
8340276 |
aaaggcttaattccacttttggacccctatcttttcaaaagttgcgcttatggacccc |
8340219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 356 - 405
Target Start/End: Original strand, 13356563 - 13356612
Alignment:
| Q |
356 |
attgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
13356563 |
attgcacttttggacccctatctttccaaaagttgcggttatggacccct |
13356612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 14647999 - 14647946
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
14647999 |
cttaattgtacttttggacccctatcttttcaaaagtcgcggttatggacccct |
14647946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 15738076 - 15738129
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
15738076 |
cttaattgcactttttgacccctatcttttcaaaagttgcggttatggatccct |
15738129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 401
Target Start/End: Complemental strand, 16597351 - 16597302
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
16597351 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
16597302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 18266354 - 18266407
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
18266354 |
cttaattgcacttttggacccctatctttccaaaggttgcggttatggacccct |
18266407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 22052441 - 22052494
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22052441 |
cttaattgcacttttggccccctatctttccaaaagttgcggttatggacccct |
22052494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 22052750 - 22052697
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22052750 |
cttaattgcaattttggacccctatctttccaaaagttgcggttatggacccct |
22052697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 23103925 - 23103978
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23103925 |
cttaattacacttttggacccctatctttccaaaagttgcggttatggacccct |
23103978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 35306712 - 35306765
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
35306712 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
35306765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 39528768 - 39528821
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39528768 |
cttaattgcacttttgaacccctatctttttaaaagttgcggttatggacccct |
39528821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 42739898 - 42739845
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
42739898 |
cttaattgcacttttggacccctatctttttaaaagttgcggttatgaacccct |
42739845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 43586097 - 43586044
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
43586097 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
43586044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 355 - 403
Target Start/End: Original strand, 1050041 - 1050089
Alignment:
| Q |
355 |
aattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
1050041 |
aattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
1050089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 405
Target Start/End: Complemental strand, 9072271 - 9072207
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |||||||| ||||| |
|
|
| T |
9072271 |
taaaaaaaaggcttaattgcacttttggacccttatctttccaaaagttgcggttatggccccct |
9072207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 13960691 - 13960743
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
13960691 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
13960743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 19849555 - 19849607
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
19849555 |
ttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
19849607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 401
Target Start/End: Complemental strand, 22925947 - 22925899
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
22925947 |
ttaattgcacttttggatccctattttttcaaaagttgtggttatggac |
22925899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 28736443 - 28736495
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
28736443 |
ttaattgcacttttggacccctatttttccaaaagttgcggttatggacccct |
28736495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 40297976 - 40297924
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
40297976 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
40297924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 931849 - 931900
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
931849 |
cttaattgtacttttggatccctatcttttcaaaagttgcggttatggaccc |
931900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 347 - 402
Target Start/End: Complemental strand, 4096767 - 4096712
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
4096767 |
aaaggcttaattgcacttttggacctttatcttttcaaaagttgcggttatggacc |
4096712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 353 - 399
Target Start/End: Complemental strand, 5891790 - 5891744
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
5891790 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
5891744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 398
Target Start/End: Original strand, 9071970 - 9072016
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
9071970 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatg |
9072016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 13356861 - 13356807
Alignment:
| Q |
352 |
cttaattgcacttttgga-cccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
13356861 |
cttaattgcacttttggatcccctatctttccaaaagttgcggttatggacccct |
13356807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 402
Target Start/End: Complemental strand, 13961001 - 13960951
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
13961001 |
cttaattgtacttttggacctctatcttttcaaaagttgcggttatggacc |
13960951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 353 - 399
Target Start/End: Complemental strand, 21347742 - 21347696
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21347742 |
ttaattgcacttttggacccctatcttttcaaaagttacggttatgg |
21347696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 23104219 - 23104165
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatctttt-caaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
23104219 |
cttaattgcacttttggacccttatcttttccaaaagttgcggttatggacccct |
23104165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 355 - 405
Target Start/End: Complemental strand, 26036524 - 26036474
Alignment:
| Q |
355 |
aattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
26036524 |
aattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
26036474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 353 - 403
Target Start/End: Original strand, 34168790 - 34168840
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
34168790 |
ttaattgcacttttggacccctatctttcaaaaagttgcggttatggaccc |
34168840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 35055778 - 35055832
Alignment:
| Q |
352 |
cttaattgcacttttgga-cccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
35055778 |
cttaattgcacttttggatcccctatctttccaaaagttgcggttatggacccct |
35055832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 346 - 400
Target Start/End: Complemental strand, 39529082 - 39529028
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
39529082 |
taaaggcttaattacacttttggacccctatctttccaaaagttgcggttatgga |
39529028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 41032508 - 41032450
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||| ||||| |||||||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
41032508 |
taaattaaaggcttaattgcacttttggatccctatctttccaaaagttgcggttatgg |
41032450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 42779168 - 42779222
Alignment:
| Q |
352 |
cttaattgcacttttgga-cccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
42779168 |
cttaattgcacttttggagcccctatctttttaaaagttgcggttatggacccct |
42779222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 339 - 405
Target Start/End: Original strand, 43585794 - 43585860
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| ||||| | ||||||||||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
43585794 |
aataaattaaaggcataattgcacttttggacccctatctttctaaaagttgcggttatggccccct |
43585860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 1055679 - 1055626
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
1055679 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatagacccct |
1055626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 2546373 - 2546426
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
2546373 |
cttaattgcacttttggacccctatctttccaaaagttacggttatgaacccct |
2546426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 2546683 - 2546630
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||| |||| |
|
|
| T |
2546683 |
cttaattgcacttttgaacccctatcttttcaaaagttgcagttatggatccct |
2546630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 3223438 - 3223491
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||| |||||||| ||||| |
|
|
| T |
3223438 |
cttaattgcacttttggacccctatctattcaaaaattgcggttatggccccct |
3223491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 353 - 402
Target Start/End: Original strand, 3738391 - 3738440
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| ||||||||||| |
|
|
| T |
3738391 |
ttaattgcacttttggactcctattttttcaaaagttgcggttatggacc |
3738440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 7219808 - 7219755
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| | ||||||| ||||||||| |||||||||||||| |
|
|
| T |
7219808 |
cttaattgcacttttggactcttatctttccaaaagttgcggttatggacccct |
7219755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 8986612 - 8986665
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
8986612 |
cttaattgcacttttggactcctatctttccaaaagttacggttatggacccct |
8986665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 10029383 - 10029330
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
10029383 |
cttaattgcacttttgaacccctatctttcgaaaagttgcggttatggacccct |
10029330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 12049428 - 12049375
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
12049428 |
cttaattgcatttttggacccctatctttccaaaagttgcggttatagacccct |
12049375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 13765572 - 13765519
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
13765572 |
cttaattgcacttttggacccctatctttcaaaaaattgcggttatggacccct |
13765519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 16079489 - 16079436
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
16079489 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatggccccct |
16079436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 19849854 - 19849801
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| ||| |||||||||| |
|
|
| T |
19849854 |
cttaattgcacttttggacccctatatttccaaaagttgcggtcatggacccct |
19849801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 401
Target Start/End: Complemental strand, 21583634 - 21583585
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| |||||||||| |
|
|
| T |
21583634 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatggac |
21583585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 22627294 - 22627241
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
22627294 |
cttaattgcacttttggatccctatcttttcaaaatttgcggttctggacccct |
22627241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 23263456 - 23263403
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||| ||||| |||||||||||||| |
|
|
| T |
23263456 |
cttaattgcacttttggacctctatctttccaacagttgcggttatggacccct |
23263403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 23502439 - 23502386
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
23502439 |
cttaattgcacttttggacccctatctttccaaaagttgctattatggacccct |
23502386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 401
Target Start/End: Original strand, 29559776 - 29559825
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
29559776 |
cttaattgcacttttggattcctatcttttcaaaagttgcggttatggac |
29559825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 32555766 - 32555819
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
32555766 |
cttaattgcatttttggacccctatctttttaaaagttgcggttatggccccct |
32555819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 353 - 402
Target Start/End: Original strand, 33203941 - 33203990
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
33203941 |
ttaattgcaattttggacccctatcttttcaaaagttgcggttatagacc |
33203990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 41140425 - 41140372
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
41140425 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggccccct |
41140372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 38992 - 39044
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| |||||||| ||||| |
|
|
| T |
38992 |
ttaattgcacttttggatccatatcttttcaaaagttgcggttatggtcccct |
39044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 4096455 - 4096507
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| | |||||||||||| |
|
|
| T |
4096455 |
ttaattgcacttttggacccctatctttctaaaagttgcgtttatggacccct |
4096507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 7623525 - 7623576
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
7623525 |
ttaattgcacttttggaccc-tatctttccaaaagttgcggttatggacccct |
7623576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 8986927 - 8986868
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttg-tggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
8986927 |
taaaggcttaattgcacttttggacccctatcttttc-aaagttgcgggttatggacccct |
8986868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 405
Target Start/End: Complemental strand, 16860127 - 16860064
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||| |||||||| |||||||| ||||| |
|
|
| T |
16860127 |
taaaataaag-cttaattgcacttttggacccctatttttctaaaagttgcggttatggtcccct |
16860064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 22626988 - 22627040
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||| |||| |||||||| |
|
|
| T |
22626988 |
ttaattgcacttttggacctctatctttccaaaagttgtagttaaggacccct |
22627040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 397
Target Start/End: Complemental strand, 28251688 - 28251644
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
28251688 |
ttaattgcacttttggacccctatctttccaaaagttgcggttat |
28251644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 355 - 399
Target Start/End: Complemental strand, 28703957 - 28703913
Alignment:
| Q |
355 |
aattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
28703957 |
aattgcacttttggacccctatctttccaaaagttgcggttatgg |
28703913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 348 - 388
Target Start/End: Original strand, 33749245 - 33749285
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccctatcttttcaaaagt |
388 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33749245 |
aagacttaattgcacttttggccccctatcttttcaaaagt |
33749285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 35678095 - 35678147
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
35678095 |
ttaattgcatttttggacccctatctttccaaaagttgcgattatggacccct |
35678147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 402
Target Start/End: Complemental strand, 35678404 - 35678344
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||| ||||||||||||||| |||||||| || ||||||| |||||||| ||||||||||| |
|
|
| T |
35678404 |
aaaaaaaagacttaattgcaattttggactcccatctttttaaaagttgcggttatggacc |
35678344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 42779478 - 42779426
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
42779478 |
ttaatcgcacttttggacctctatctttccaaaaattgtggttatggacccct |
42779426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 352 - 399
Target Start/End: Complemental strand, 32556056 - 32556009
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
32556056 |
cttaattgcacttttggacccatatctttccaaaagttgcggttatgg |
32556009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 42947398 - 42947453
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||| |||||||| ||||||||||| |
|
|
| T |
42947398 |
aaaggcttaattgcacttttggactcctatctttctaaaagttgcggttatggacc |
42947453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 39280 - 39242
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39280 |
cttaattgcacttttggatccctatcttttcaaaagttg |
39242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 6815502 - 6815540
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6815502 |
cttaattgcacttttggccccctatcttttcaaaagttg |
6815540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 17235316 - 17235278
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17235316 |
cttaattgcacttttggtcccctatcttttcaaaagttg |
17235278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 20465500 - 20465558
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
20465500 |
aaaggcttaattacacttttggacccctatctttccaaaagttgcagttatggccccct |
20465558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 402
Target Start/End: Original strand, 21583325 - 21583375
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
21583325 |
cttaattgcactttgggacctctatctttccaaaagttgcggttatggacc |
21583375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 23695523 - 23695581
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||| ||| ||| | ||||||| |||||||||||||| |
|
|
| T |
23695523 |
aaaggcttaattgcacttttggacccatatttttcccaaagttgcggttatggacccct |
23695581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 24396118 - 24396064
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatc-ttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| ||||||||||||||||| ||||| |
|
|
| T |
24396118 |
cttaattgcacttttggacctctatcttttttaaaagttgtggttatggtcccct |
24396064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 3728286 - 3728339
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| ||||||||||| |||||||| ||||||||| |||||||| ||||| |
|
|
| T |
3728286 |
cttaattgtacttttggacctctatctttccaaaagttgcggttatggtcccct |
3728339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 4146449 - 4146396
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||| || ||| ||||| |
|
|
| T |
4146449 |
cttaattgcacttttggccccctatctttccaaaagttgtgattttggtcccct |
4146396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 333 - 390
Target Start/End: Complemental strand, 20041040 - 20040984
Alignment:
| Q |
333 |
aaaaataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||| || |||| ||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20041040 |
aaaaaaaaaaaaaaaaaaacttaattgcacttttgg-cccctatcttttcaaaagttg |
20040984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 26152103 - 26152050
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||| ||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
26152103 |
cttaattgtacttttagacccatatctttccaaaagttgcggttatggacccct |
26152050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 29560092 - 29560035
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
|||| |||||||||| || |||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
29560092 |
aaaggcttaattgcatttatggacccctatctttttaaaagttgcggttatagacccc |
29560035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 3738546 - 3738494
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| | ||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
3738546 |
ttaattgtatttttggacctctatctttttaaaagttgcggttatggacccct |
3738494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 4146110 - 4146162
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||| | || ||||||||| |
|
|
| T |
4146110 |
ttaattgcatttttggccccctatcttttcaaaagttgcgattttggacccct |
4146162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 355 - 399
Target Start/End: Original strand, 9559859 - 9559903
Alignment:
| Q |
355 |
aattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||| |||||||| |
|
|
| T |
9559859 |
aattgcacttttggatctctatcttttcaaaagttgcggttatgg |
9559903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 392
Target Start/End: Complemental strand, 12610585 - 12610545
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtg |
392 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
12610585 |
cttaattgcacttttggccctctatcttttcaaaagttgtg |
12610545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 16329585 - 16329636
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| |||||||| | ||||||||||||||||| |||||||||||||| |
|
|
| T |
16329585 |
ttaattgcaattttggactc-tatcttttcaaaagttgcggttatggacccct |
16329636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 349 - 389
Target Start/End: Original strand, 16822782 - 16822822
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
16822782 |
agacttaattgcacttttggccccctatctttttaaaagtt |
16822822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 404
Target Start/End: Original strand, 22925701 - 22925753
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
|||||||||||||||| ||| |||||||| ||||||||| |||||| |||||| |
|
|
| T |
22925701 |
cttaattgcacttttgaacctctatctttccaaaagttgcggttatagacccc |
22925753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 405
Target Start/End: Complemental strand, 28388302 - 28388238
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||| ||||||||| | |||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
28388302 |
taaattaaaggcttaattgcgcaattggacccctatctttccaaaaattgaggttatggacccct |
28388238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 363 - 402
Target Start/End: Original strand, 10029087 - 10029126
Alignment:
| Q |
363 |
ttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
10029087 |
ttttggacccctatctttccaaaagttgcggttatggacc |
10029126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 347 - 390
Target Start/End: Original strand, 12610241 - 12610284
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
12610241 |
aaaggcttaattgcacttttggccccctatctttttaaaagttg |
12610284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 347 - 389
Target Start/End: Complemental strand, 6815745 - 6815703
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
|||| ||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
6815745 |
aaaggcttaattgcacttttggccctctatcttttcaaaagtt |
6815703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 9560145 - 9560099
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||| ||||||| |
|
|
| T |
9560145 |
cttaattgcatttttggacccctatctttctaaaagttgcggttatg |
9560099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 10331958 - 10331996
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10331958 |
cttaattgcacttttgaccccctatcttttcaaaagttg |
10331996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 388
Target Start/End: Complemental strand, 15221531 - 15221489
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagt |
388 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
15221531 |
taaaggcttaattgcacttttggacccatatctttccaaaagt |
15221489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 17235138 - 17235176
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
17235138 |
cttaattgtacttttggccccctatcttttcaaaagttg |
17235176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 25693903 - 25693941
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
25693903 |
cttaattgtacttttggccccctatcttttcaaaagttg |
25693941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 402
Target Start/End: Complemental strand, 29391325 - 29391275
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||| ||| | ||||||| ||||||||| ||||||||||| |
|
|
| T |
29391325 |
cttaattgcacttttagactcttatctttccaaaagttgcggttatggacc |
29391275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 37060209 - 37060171
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
37060209 |
cttaattgcacttttggccccctatctttccaaaagttg |
37060171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 37333849 - 37333791
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||| |||||||| |||| ||| ||||| |
|
|
| T |
37333849 |
aaaggcttaattgcacttttggacccttatctttctaaaagttgcggttttggtcccct |
37333791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 37887674 - 37887712
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37887674 |
cttaattgcacttttgaccccctatcttttcaaaagttg |
37887712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 39573837 - 39573799
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
39573837 |
cttaattgcacttttggtcccctatctttttaaaagttg |
39573799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 3728575 - 3728522
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| | |||||||| |||||||| |||||||| ||||| |
|
|
| T |
3728575 |
cttaattgcacttttggatctctatctttccaaaagttacggttatggccccct |
3728522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 390
Target Start/End: Complemental strand, 8006323 - 8006286
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
8006323 |
ttaattgcacttttggcctcctatcttttcaaaagttg |
8006286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 390
Target Start/End: Original strand, 10169018 - 10169055
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
10169018 |
ttaattgcacttttggccccctatctttttaaaagttg |
10169055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 390
Target Start/End: Complemental strand, 14514994 - 14514957
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
14514994 |
ttaattgcacttttggccccctatctttccaaaagttg |
14514957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 349 - 405
Target Start/End: Original strand, 28387979 - 28388036
Alignment:
| Q |
349 |
agacttaattgcacttttgga-cccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
28387979 |
agacataattgcacttttggaccccctatctttccaaaagttgcgtgtatggacccct |
28388036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 405
Target Start/End: Complemental strand, 33204261 - 33204197
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||| ||||||||||||||||| || ||| |||||||||||| |||||||||||||| |
|
|
| T |
33204261 |
ataaaattaaggtttaattgcacttttggatcc-tattttttcaaaagttacggttatggacccct |
33204197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 380
Target Start/End: Complemental strand, 11709450 - 11709422
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttt |
380 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11709450 |
cttaattgcacttttggacccctatcttt |
11709422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 25631391 - 25631339
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| | |||| ||| |||||||| |||||||||||||| |
|
|
| T |
25631391 |
ttaattgcacttttggatctctatttttctaaaagttgcggttatggacccct |
25631339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 31172570 - 31172619
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| | |||||||||||| |
|
|
| T |
31172570 |
cttaattgcacttttggacccctatct----aaaagttgcgattatggacccct |
31172619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 356 - 400
Target Start/End: Complemental strand, 33825905 - 33825862
Alignment:
| Q |
356 |
attgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
|||||||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
33825905 |
attgcacttttggatcc-tgtcttttcaaaagttgtggttatgga |
33825862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 333 - 381
Target Start/End: Original strand, 38973311 - 38973359
Alignment:
| Q |
333 |
aaaaataataaaataaagacttaattgcacttttggacccctatctttt |
381 |
Q |
| |
|
||||| |||| ||||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
38973311 |
aaaaaaaatagaataaaggcttaattgcacttttggccccctatgtttt |
38973359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 41138553 - 41138601
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||| ||||||||||||||| | ||||||||||| |||||||| |
|
|
| T |
41138553 |
aaaataaaggcttaattgcacttttagccccctatctttctaaaagttg |
41138601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 338 - 386
Target Start/End: Complemental strand, 43223016 - 43222968
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaa |
386 |
Q |
| |
|
||||| || ||||||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
43223016 |
taatataaaaaagacttaattgtacttttggccccctatctttccaaaa |
43222968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 2e-22; HSPs: 147)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 332 - 405
Target Start/End: Complemental strand, 1467142 - 1467066
Alignment:
| Q |
332 |
taaaaataataaaataa---agacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1467142 |
taaaaattataaaataattaaggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
1467066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 15977520 - 15977467
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15977520 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
15977467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 21552543 - 21552596
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21552543 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
21552596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 350 - 405
Target Start/End: Complemental strand, 1375474 - 1375419
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1375474 |
gacttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1375419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 24205291 - 24205349
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24205291 |
aaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
24205349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 31784249 - 31784307
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31784249 |
aaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31784307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 339 - 405
Target Start/End: Complemental strand, 40493968 - 40493903
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40493968 |
aataaaataagg-cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40493903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 20494341 - 20494394
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20494341 |
cttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
20494394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 336 - 405
Target Start/End: Complemental strand, 22093545 - 22093476
Alignment:
| Q |
336 |
aataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
22093545 |
aataataaaaagaaggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
22093476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 22194759 - 22194706
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22194759 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22194706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 22699458 - 22699511
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22699458 |
cttaattgtacttttggacccctatcttttcaaaagttgtggttatggacccct |
22699511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 24895222 - 24895169
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24895222 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
24895169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 39642731 - 39642784
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39642731 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
39642784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 338 - 405
Target Start/End: Original strand, 20436046 - 20436113
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20436046 |
taataaaatttaggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
20436113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 1375402 - 1375344
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
1375402 |
aaagacttaattgaacttttggacccctatctttccaaaagttgcggttatggacccct |
1375344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 339 - 405
Target Start/End: Complemental strand, 25888215 - 25888149
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
25888215 |
aataaagtaaaggcttaattgcacttttggacccctatctttacaaaagttacggttatggacccct |
25888149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 1466812 - 1466865
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
1466812 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1466865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 2936791 - 2936844
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
2936791 |
cttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
2936844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 350 - 403
Target Start/End: Original strand, 13123422 - 13123475
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
13123422 |
gacttaattgcacttttggacccctatctttttaaaagttgaggttatggaccc |
13123475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 19256900 - 19256847
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
19256900 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19256847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 21552852 - 21552799
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
21552852 |
cttaattgcacttttggacccatatcttttcaaaagttgcggttatggacccct |
21552799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 22093237 - 22093290
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22093237 |
cttaaatgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22093290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 36987724 - 36987671
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
36987724 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36987671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 40493648 - 40493701
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
40493648 |
cttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
40493701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 401
Target Start/End: Original strand, 11362564 - 11362612
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11362564 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
11362612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 337 - 405
Target Start/End: Complemental strand, 21568251 - 21568183
Alignment:
| Q |
337 |
ataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||| |||||||||| ||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
21568251 |
ataaaaaaataaaagcttaattgcatttttggatccctatcttttcaaaagttgcggttatggacccct |
21568183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 35699162 - 35699110
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
35699162 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35699110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 340 - 396
Target Start/End: Complemental strand, 40445876 - 40445820
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40445876 |
ataaaataaaggcttaattgcacttttggacccctatctttctaaaagttgtggtta |
40445820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 41829775 - 41829723
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
41829775 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
41829723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 42445375 - 42445427
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
42445375 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42445427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 338 - 405
Target Start/End: Complemental strand, 23000834 - 23000767
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
23000834 |
taataaaaataaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
23000767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 339 - 405
Target Start/End: Complemental strand, 3263340 - 3263274
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
3263340 |
aataaaataaaggcttacttgcacttttggacccctatctttctaaaagttgcggttatggccccct |
3263274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 349 - 403
Target Start/End: Original strand, 7463946 - 7464000
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||| |||| |
|
|
| T |
7463946 |
agacttaattgcacttttgaacccctatctttttaaaagttgtggttatgtaccc |
7464000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 348 - 398
Target Start/End: Complemental strand, 8739144 - 8739094
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8739144 |
aagatttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
8739094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 11362877 - 11362819
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
11362877 |
aaagacttaattatacttttggacccctatcatttcaaaagttgcggttatggacccct |
11362819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 13485489 - 13485431
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13485489 |
aaaggcttaattgcacttttatacccctatcttttcaaaagttgcggttatggacccct |
13485431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 352 - 402
Target Start/End: Original strand, 33004711 - 33004761
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33004711 |
cttaattgcacttttggacccctatcttttcaaaagttgcagttatggacc |
33004761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 33005004 - 33004950
Alignment:
| Q |
352 |
cttaattgcacttttgga-cccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33005004 |
cttaattgcacttttggatcccctatcttttcaaaagttgcggttatggacccct |
33004950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 349 - 399
Target Start/End: Original strand, 36566602 - 36566652
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
36566602 |
agacttaattgcacttctggacccctatcttttcaaaagttgcggttatgg |
36566652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 40711333 - 40711391
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||| | |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40711333 |
aaaggcttaattgtatttttggacccctatcttttcaaaagttgcggttatggacccct |
40711391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 1375048 - 1375101
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
1375048 |
cttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
1375101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 348 - 405
Target Start/End: Original strand, 12542137 - 12542194
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
12542137 |
aagacttaattgcacttttggccccctatcttttcaaaagttgtgattttggccccct |
12542194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 17798850 - 17798903
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
17798850 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
17798903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 19025821 - 19025878
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
19025821 |
aaaggcttaattgcactttttgacccctatcttttcaaaagttgcggttatgaacccc |
19025878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 22194450 - 22194503
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22194450 |
cttaatttcatttttggacccctatcttttcaaaagttgcggttatggacccct |
22194503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 24858187 - 24858134
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||| |||||| |
|
|
| T |
24858187 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatgaacccct |
24858134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 25429924 - 25429977
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
25429924 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
25429977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 31784562 - 31784509
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
31784562 |
cttaattgcatttttggatccctatcttttcaaaagttgcggttatggacccct |
31784509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 36589733 - 36589786
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
36589733 |
cttaattgcacttttggacccttatcttttcaaaagttgcggttatggccccct |
36589786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 36987414 - 36987467
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
36987414 |
cttaattgcacttttggacccctatctttccaaaagttgcgtttatggacccct |
36987467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 397
Target Start/End: Original strand, 38731281 - 38731326
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38731281 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttat |
38731326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 40324636 - 40324689
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| | |||||||||||| |
|
|
| T |
40324636 |
cttaattgcacttttggatccctatcttttcaaaagttgcgattatggacccct |
40324689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 41071831 - 41071884
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
41071831 |
cttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
41071884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 41072139 - 41072086
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
41072139 |
cttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
41072086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 45127147 - 45127094
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
45127147 |
cttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
45127094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 315021 - 315073
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
315021 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
315073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 1374801 - 1374853
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
1374801 |
ttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
1374853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 17799139 - 17799087
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
17799139 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
17799087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 352 - 400
Target Start/End: Original strand, 24894971 - 24895019
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
24894971 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatgga |
24895019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 347 - 398
Target Start/End: Complemental strand, 19368809 - 19368758
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
19368809 |
aaaggcttaattgcacttttggacccttatcttttcaaaagttgcggttatg |
19368758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 362 - 405
Target Start/End: Complemental strand, 24205597 - 24205554
Alignment:
| Q |
362 |
cttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24205597 |
cttttggacccctatcttttcaaaagttgcggttatggacccct |
24205554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 338 - 401
Target Start/End: Original strand, 24857871 - 24857934
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| |||||||| ||||||||| |||||||||| |
|
|
| T |
24857871 |
taataaaaaaaaggtttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
24857934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 339 - 402
Target Start/End: Complemental strand, 34981706 - 34981643
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||| ||| | ||||||||| |||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34981706 |
aataaaaaaaaaatttaattgcatttttagacccctatcttttcaaaagttgcggttatggacc |
34981643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 399
Target Start/End: Complemental strand, 36590023 - 36589976
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
36590023 |
cttaattgcacttttggacccttatcttttcaaaagttgcggttatgg |
36589976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 350 - 405
Target Start/End: Original strand, 45395231 - 45395286
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||| ||||||| |||||| |
|
|
| T |
45395231 |
gacttaattgcacttttggacccctacctttccaaaagttgcggttatgtacccct |
45395286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 339 - 405
Target Start/End: Complemental strand, 7464263 - 7464197
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||| ||||||||||||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
7464263 |
aataaaaagaaggcttaattgcacttttggactcctatctttccaaaagttacggttatggacccct |
7464197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 19889541 - 19889491
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
19889541 |
ataaaataaaggcttaattgcacttttggccccatatcttttcaaaagttg |
19889491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 25430086 - 25430028
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
25430086 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcagttatggccccct |
25430028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 402
Target Start/End: Original strand, 25887896 - 25887946
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
25887896 |
cttaattgcacttttggacccttatctttccaaaagttgcggttatggacc |
25887946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 39620542 - 39620600
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
39620542 |
aaaggcttaattgcacttttgggtccctatctttccaaaagttgcggttatggacccct |
39620600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 7537415 - 7537468
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||| ||||| |||||||| |
|
|
| T |
7537415 |
cttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
7537468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 353 - 402
Target Start/End: Original strand, 8519269 - 8519318
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| ||||||||||| |
|
|
| T |
8519269 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatggacc |
8519318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 9715160 - 9715107
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||| |||| ||||| |
|
|
| T |
9715160 |
cttaattgcacttttggacccctatctttccaaaagttgcggtcatggccccct |
9715107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 13732478 - 13732425
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
13732478 |
cttaattgcacttttggatccctatctttctaaaagttgcggttatggacccct |
13732425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 15977210 - 15977263
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||| || ||||||| ||||||||||||| |
|
|
| T |
15977210 |
cttaattgcacttttggacccctatttttccagaagttgtagttatggacccct |
15977263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 20436364 - 20436311
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
20436364 |
cttaattacacttttggacccctattttttcaaaagttgctgttatggacccct |
20436311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 21843491 - 21843438
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
21843491 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
21843438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 26717452 - 26717399
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| |||||||| ||||| |
|
|
| T |
26717452 |
cttaattgcacttttggacccatatctttccaaaagttgcggttatggccccct |
26717399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 34850968 - 34850915
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
34850968 |
cttaattgcacttttggacccctatctttccaaaagttgcagttatggccccct |
34850915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 38731590 - 38731537
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||| ||||||| |
|
|
| T |
38731590 |
cttaattgcacttttggactcctatcttttcaaaagttgcagttattgacccct |
38731537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 39431480 - 39431427
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
39431480 |
cttaattgcacttttgaacctctatctttttaaaagttgcggttatggacccct |
39431427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 40324941 - 40324888
Alignment:
| Q |
353 |
ttaattgcactttt-ggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
40324941 |
ttaattgcactttttggacccctatctttccaaaagttgcggttatggacccct |
40324888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 40506205 - 40506258
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||| |||||||| ||||| |
|
|
| T |
40506205 |
cttaattgcacttttggaccccaatctttccaaaagttgcggttatggccccct |
40506258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 42445683 - 42445630
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
42445683 |
cttaattgcacttttggatccctatctttctaaaagttgcggttatggacccct |
42445630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 45126841 - 45126894
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||| | | ||||||||| |||||||||||||| |
|
|
| T |
45126841 |
cttaattgcacttttggacccctatatatccaaaagttgcggttatggacccct |
45126894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 349 - 405
Target Start/End: Original strand, 9484700 - 9484756
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
9484700 |
agacttaattgcacttttaaacctctatctttccaaaagttgcggttatggacccct |
9484756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 338 - 398
Target Start/End: Complemental strand, 30219031 - 30218971
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||| | ||| ||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
30219031 |
taataaatttaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
30218971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 34123245 - 34123296
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
34123245 |
ttaattgcacttttggaccc-tatctttccaaaagttgcggttatggacccct |
34123296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 345 - 405
Target Start/End: Complemental strand, 39620866 - 39620806
Alignment:
| Q |
345 |
ataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| || ||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |
|
|
| T |
39620866 |
ataaaggctaaattgcacttttggacctctattttttcaaaatttgcggttatggacccct |
39620806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 41829470 - 41829522
Alignment:
| Q |
352 |
cttaattgcactttt-ggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
41829470 |
cttaattgcactttttggacccctatctttccaaaagttgcggttatggaccc |
41829522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 352 - 399
Target Start/End: Original strand, 3263037 - 3263084
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
3263037 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatgg |
3263084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 352 - 395
Target Start/End: Complemental strand, 10741389 - 10741346
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtt |
395 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
10741389 |
cttaattgcacttttggccccctatcttttcaaaagttgcggtt |
10741346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 11367111 - 11367060
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| || ||||||||| |
|
|
| T |
11367111 |
cttaattgcacttttggacccttatctttccaaaagttgcggctatggaccc |
11367060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 390
Target Start/End: Complemental strand, 41454870 - 41454815
Alignment:
| Q |
335 |
aaataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||| || ||| ||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
41454870 |
aaataataatattaaggcttaattgcacgtttggccccctatcttttcaaaagttg |
41454815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 45395555 - 45395496
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| |||| ||| |||||||||||||| |
|
|
| T |
45395555 |
taaaggcttaattgcacttttggatccctatctttctaaaaattgcggttatggacccct |
45395496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 353 - 399
Target Start/End: Complemental strand, 1381038 - 1380992
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1381038 |
ttaattgcatttttggctccctatcttttcaaaagttgtggttatgg |
1380992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 2755261 - 2755223
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2755261 |
cttaattgcacttttggccccctatcttttcaaaagttg |
2755223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 5036506 - 5036564
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||||| |||||||| |||||||| ||||| |
|
|
| T |
5036506 |
aaaggcttaattgcacttttggactcttatctttttaaaagttgcggttatggccccct |
5036564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 11366800 - 11366854
Alignment:
| Q |
352 |
cttaattgcacttttggacccc-tatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| |||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
11366800 |
cttaattacacttttggaccccctatctttccaaaagttgcggttatggacccct |
11366854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 353 - 399
Target Start/End: Complemental strand, 19473325 - 19473279
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
19473325 |
ttaattgcacttttggacccttatctttccaaaagttgcggttatgg |
19473279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 31025877 - 31025915
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31025877 |
cttaattgcacttttggccccctatcttttcaaaagttg |
31025915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 32661406 - 32661444
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32661406 |
cttaattgcacttttggccccctatcttttcaaaagttg |
32661444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 34470031 - 34470069
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34470031 |
cttaattgcacttttggccccctatcttttcaaaagttg |
34470069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 36566762 - 36566716
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||| ||||||| |
|
|
| T |
36566762 |
cttaattgcacttctggacccctatctttccaaaagttgcggttatg |
36566716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 41454514 - 41454552
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41454514 |
cttaattgcacttttggccccctatcttttcaaaagttg |
41454552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 2382868 - 2382815
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
2382868 |
cttaattgcacttttaaacccctatatttccaaaagttgcggttatggacccct |
2382815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 349 - 390
Target Start/End: Complemental strand, 4094873 - 4094832
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
4094873 |
agacttaattgcactttttgccccctatcttttcaaaagttg |
4094832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 353 - 390
Target Start/End: Complemental strand, 11134053 - 11134016
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11134053 |
ttaattgcacttttggtcccctatcttttcaaaagttg |
11134016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 19473078 - 19473131
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
19473078 |
cttaattgcatttttggacccctatctttctaaaagttgcggttatggccccct |
19473131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 349 - 390
Target Start/End: Original strand, 19885858 - 19885898
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19885858 |
agacttaattgcacttttgg-cccctatcttttcaaaagttg |
19885898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 401
Target Start/End: Complemental strand, 34123552 - 34123503
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||| ||||||||| |||| |||||||| |||||||||| |
|
|
| T |
34123552 |
cttaattgcacttttagacccctattttttaaaaagttgcggttatggac |
34123503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 353 - 390
Target Start/End: Original strand, 34922227 - 34922264
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34922227 |
ttaattgcacttttggccccctatcttttcaaaagttg |
34922264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 401
Target Start/End: Complemental strand, 39245976 - 39245927
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| | |||||||| |
|
|
| T |
39245976 |
cttaattgcacttttggacccatatctttccaaaagttgcgattatggac |
39245927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 19026127 - 19026075
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| | |||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
19026127 |
ttaattgcacttttgaatccctatctttccaaaagttgcggttatagacccct |
19026075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 23000530 - 23000582
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| ||| ||| ||||||||| |||||||| ||||| |
|
|
| T |
23000530 |
ttaattgcacttttggacccttatttttccaaaagttgcggttatggccccct |
23000582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 388
Target Start/End: Original strand, 26717160 - 26717196
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagt |
388 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26717160 |
cttaattgcacttttggacccctatctttccaaaagt |
26717196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 39431172 - 39431224
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| || |||||||| ||||||||| |||||||||||||| |
|
|
| T |
39431172 |
ttaattgcacttttgaacttctatctttccaaaagttgcggttatggacccct |
39431224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 392
Target Start/End: Original strand, 40938796 - 40938836
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtg |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40938796 |
cttaattgcacttttgaccccctatcttttcaaaagttgtg |
40938836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 352 - 399
Target Start/End: Complemental strand, 315314 - 315267
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||| |||||||| |
|
|
| T |
315314 |
cttaattgcacttttggacccatatctttctaaaagttgcggttatgg |
315267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 11017597 - 11017660
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| |||||||| ||||||||||||| |||||| |||||||| |||||| ||||||| |
|
|
| T |
11017597 |
aaaaaaaaggcttaattgtacttttggaccccaatctttcaaaaagttgcggttatagacccct |
11017660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 22136895 - 22136946
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
22136895 |
cttaattgcacttttagacccctatctttccaaaagttacagttatggaccc |
22136946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 34981387 - 34981437
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
34981387 |
cttaattgcatttttggaccc-tatcttttcaaaagttgcggttatagaccc |
34981437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 347 - 390
Target Start/End: Complemental strand, 36286470 - 36286427
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
36286470 |
aaaggcttaattgcacttttggccccctatctttccaaaagttg |
36286427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 2937104 - 2937047
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||| ||||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
2937104 |
aaaggcttaattgca-ttttggacctctatctttctaaaagttgcggttatggacccct |
2937047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 386
Target Start/End: Complemental strand, 3339197 - 3339163
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaa |
386 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3339197 |
cttaattgcacttttggccccctatcttttcaaaa |
3339163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 9714859 - 9714917
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||| ||| |||||||||||||||| || ||||||||| ||||||||| || ||||| |
|
|
| T |
9714859 |
taaaattaaggcttaattgcacttttgaactcctatctttccaaaagttgcggctatgg |
9714917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 10857341 - 10857379
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
10857341 |
cttaattgcacttttggccccctatctttccaaaagttg |
10857379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 11188308 - 11188346
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11188308 |
cttaattgcacttttgaccccctatcttttcaaaagttg |
11188346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 12542468 - 12542430
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
12542468 |
cttaattgcacttttggccctctatcttttcaaaagttg |
12542430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 16865321 - 16865359
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
16865321 |
cttaattgcacttttggccccctatctttccaaaagttg |
16865359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 21024772 - 21024734
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21024772 |
cttaattgcacttttgaccccctatcttttcaaaagttg |
21024734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 32661746 - 32661708
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
32661746 |
cttaattgcacttttggccccctatctttccaaaagttg |
32661708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 34600549 - 34600587
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
34600549 |
cttaattgcacttttggccccctatctttccaaaagttg |
34600587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 353 - 399
Target Start/End: Original strand, 34850680 - 34850726
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||||| ||| ||| ||||||||| |||||||| |
|
|
| T |
34850680 |
ttaattgcacttttggacccttatttttccaaaagttgcggttatgg |
34850726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 35173124 - 35173087
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35173124 |
cttaattgcacttttgg-cccctatcttttcaaaagttg |
35173087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 37334607 - 37334644
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37334607 |
cttaattgcacttttgg-cccctatcttttcaaaagttg |
37334644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 37343994 - 37343956
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
37343994 |
cttaattgcacttttggcctcctatcttttcaaaagttg |
37343956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 39374102 - 39374140
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
39374102 |
cttaattgcacttttggccctctatcttttcaaaagttg |
39374140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 398
Target Start/End: Original strand, 40445575 - 40445621
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| |||| ||||||| |
|
|
| T |
40445575 |
cttaattgcacttttggacccatatctttccaaacgttgcggttatg |
40445621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 390
Target Start/End: Complemental strand, 3414910 - 3414873
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
3414910 |
ttaattgcacttttgaacccctatctttccaaaagttg |
3414873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 397
Target Start/End: Original strand, 8738850 - 8738895
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| ||| |||||| |
|
|
| T |
8738850 |
cttaattgcacttttggacccctacctttacaaaaattgcggttat |
8738895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 13123732 - 13123679
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||||||| | |||||||||||| |
|
|
| T |
13123732 |
cttaattgcacttatggatccctattttttcaaaagttacgtttatggacccct |
13123679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 345 - 390
Target Start/End: Original strand, 36286118 - 36286163
Alignment:
| Q |
345 |
ataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||| ||||||||||||||||| || |||| ||||||||||||| |
|
|
| T |
36286118 |
ataaaggcttaattgcacttttggccctctatattttcaaaagttg |
36286163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 345 - 390
Target Start/End: Complemental strand, 39374448 - 39374403
Alignment:
| Q |
345 |
ataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||| |||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
39374448 |
ataaaggcttaattgcacttttgaccccctatattttcaaaagttg |
39374403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 405
Target Start/End: Complemental strand, 40506507 - 40506442
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||| |||||||||||||||| | ||||||||| |||||||| ||||| || ||||| |
|
|
| T |
40506507 |
ataaaataaaggtttaattgcacttttggtctcctatctttctaaaagttgcggttacggccccct |
40506442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 396
Target Start/End: Original strand, 17096913 - 17096957
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
|||||||||||||||||| ||||| |||| ||||||||| ||||| |
|
|
| T |
17096913 |
cttaattgcacttttggatccctaactttccaaaagttgcggtta |
17096957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 396
Target Start/End: Complemental strand, 17102620 - 17102576
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
|||||||||||||||| ||||||| |||| ||||||||| ||||| |
|
|
| T |
17102620 |
cttaattgcacttttgaacccctaactttccaaaagttgcggtta |
17102576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 54; Significance: 7e-22; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 238624 - 238677
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
238624 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
238677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 333 - 405
Target Start/End: Complemental strand, 238954 - 238882
Alignment:
| Q |
333 |
aaaaataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||| | || ||||||||||||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
238954 |
aaaaataataaaaaataggcttaattgcacttttggacccctatctttccaaaagttgcggttatgtacccct |
238882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 7e-22; HSPs: 168)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 340 - 405
Target Start/End: Original strand, 38166474 - 38166539
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
38166474 |
ataaaattaagacttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
38166539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 42267458 - 42267511
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42267458 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
42267511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 17943354 - 17943413
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17943354 |
taaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
17943413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 343 - 405
Target Start/End: Original strand, 994986 - 995048
Alignment:
| Q |
343 |
aaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
994986 |
aaataaaggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
995048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 339 - 405
Target Start/End: Original strand, 6014408 - 6014474
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6014408 |
aataaaatctaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
6014474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 23234096 - 23234038
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23234096 |
aaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23234038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 414966 - 414913
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
414966 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
414913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 995309 - 995252
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
995309 |
aagacttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
995252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 2321518 - 2321571
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2321518 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
2321571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 4167511 - 4167458
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4167511 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
4167458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 36226726 - 36226673
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36226726 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
36226673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 344 - 405
Target Start/End: Original strand, 36788248 - 36788309
Alignment:
| Q |
344 |
aataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
36788248 |
aataaagacttaattgcacttttggacccctatctttccaaaagttgcggttatagacccct |
36788309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 340 - 405
Target Start/End: Complemental strand, 37205864 - 37205799
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
37205864 |
ataaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37205799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 37953376 - 37953429
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37953376 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37953429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 340 - 405
Target Start/End: Original strand, 41625450 - 41625515
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| |||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
41625450 |
ataaaacaaaggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
41625515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 45106437 - 45106490
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45106437 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45106490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 340 - 405
Target Start/End: Complemental strand, 45209299 - 45209234
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
45209299 |
ataaaaaaaaggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
45209234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 4147094 - 4147042
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4147094 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
4147042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 37277770 - 37277718
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37277770 |
ttaattgcacttttggacccctatcttttcaaaagttatggttatggacccct |
37277718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 343 - 403
Target Start/End: Original strand, 37639500 - 37639560
Alignment:
| Q |
343 |
aaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
37639500 |
aaataaaggcttaattgcacttttggacccctatcttttcaaaagttgaggttttggaccc |
37639560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 37953683 - 37953631
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37953683 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37953631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 349 - 405
Target Start/End: Complemental strand, 38166800 - 38166744
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
38166800 |
agacttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
38166744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 44886214 - 44886162
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44886214 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
44886162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 350 - 405
Target Start/End: Complemental strand, 8834252 - 8834197
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
8834252 |
gacttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
8834197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 20819748 - 20819807
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
20819748 |
taaaggcttaattgcacttttggaccactatcttttcaaaagttgcggttatggacccct |
20819807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 27339535 - 27339598
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
27339535 |
aaaatataggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
27339598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 342 - 405
Target Start/End: Complemental strand, 41206453 - 41206390
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
41206453 |
aaaataaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggccccct |
41206390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 403
Target Start/End: Complemental strand, 8287926 - 8287864
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||| |||| |||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8287926 |
taaaaaaaaggcttagttgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
8287864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 414669 - 414722
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
414669 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
414722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 1657390 - 1657443
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1657390 |
cttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
1657443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 1657696 - 1657643
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
1657696 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1657643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 2321828 - 2321775
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
2321828 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatgaacccct |
2321775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 4146787 - 4146840
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4146787 |
cttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
4146840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 5734496 - 5734443
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
5734496 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5734443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 6107428 - 6107375
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
6107428 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6107375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 6335334 - 6335387
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
6335334 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
6335387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 6335639 - 6335586
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
6335639 |
cttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccct |
6335586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 6641909 - 6641856
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
6641909 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
6641856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 7151153 - 7151100
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
7151153 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7151100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 14032038 - 14032091
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
14032038 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
14032091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 14032344 - 14032291
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14032344 |
cttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
14032291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 15187930 - 15187983
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
15187930 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
15187983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 16531560 - 16531507
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16531560 |
cttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
16531507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 20095688 - 20095741
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20095688 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20095741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 338 - 399
Target Start/End: Original strand, 20791004 - 20791065
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
20791004 |
taataaagaaaagacttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
20791065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 20813738 - 20813791
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20813738 |
cttaattgcacttgtggacccctatcttttcaaaagttgcggttatggacccct |
20813791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 30359153 - 30359100
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
30359153 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30359100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 30845871 - 30845818
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
30845871 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30845818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 39515560 - 39515613
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
39515560 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
39515613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 42267769 - 42267716
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
42267769 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42267716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 1985879 - 1985827
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
1985879 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1985827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 25249957 - 25250009
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25249957 |
ttaattgtacttttggacccctatcttttcaaaagttgcggttatggacccct |
25250009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 33881397 - 33881345
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
33881397 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
33881345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 41015101 - 41015049
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
41015101 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggccccct |
41015049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 44885907 - 44885959
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
44885907 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
44885959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 350 - 405
Target Start/End: Original strand, 6641596 - 6641651
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
6641596 |
gacttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
6641651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 342 - 405
Target Start/End: Complemental strand, 6745315 - 6745252
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||| ||| || ||||||| |
|
|
| T |
6745315 |
aaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggtaatagacccct |
6745252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 8870261 - 8870312
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
8870261 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
8870312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 32332132 - 32332195
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
32332132 |
aaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttttggacccct |
32332195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 38593189 - 38593240
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
38593189 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
38593240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 4107159 - 4107113
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4107159 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
4107113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 5734181 - 5734239
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||| ||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5734181 |
aaaggcttaattgcatttttgaacccctatcttttcaaaagttgcggttatggacccct |
5734239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 31191786 - 31191728
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
31191786 |
aaaggcttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
31191728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 352 - 401
Target Start/End: Complemental strand, 33877808 - 33877758
Alignment:
| Q |
352 |
cttaattgcacttttggacccc-tatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33877808 |
cttaattgcacttttggaccccctatcttttcaaaagttgtggttatggac |
33877758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 352 - 402
Target Start/End: Complemental strand, 42906685 - 42906635
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
42906685 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
42906635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 4132756 - 4132809
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
4132756 |
cttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
4132809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 4133066 - 4133013
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
4133066 |
cttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
4133013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 4167206 - 4167259
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||| ||||||| |
|
|
| T |
4167206 |
cttaattgcacttttggacgcctattttttcaaaagttgtggttattgacccct |
4167259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 6014729 - 6014676
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
6014729 |
cttaattgcacttttggatccctatctttttaaaagttgcggttatggacccct |
6014676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 6107119 - 6107172
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
6107119 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
6107172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 14024351 - 14024298
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
14024351 |
cttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
14024298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 18553282 - 18553229
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
18553282 |
cttaattgcaattttggacccctatctttccaaaagttgcggttatggacccct |
18553229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 20095998 - 20095945
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
20095998 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgggcccct |
20095945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 20283986 - 20283933
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
20283986 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
20283933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 20814052 - 20813999
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
20814052 |
cttaattgcacttttggacccctatctttccaaaacttgcggttatggacccct |
20813999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 21070614 - 21070561
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
21070614 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
21070561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 397
Target Start/End: Original strand, 23233783 - 23233828
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23233783 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttat |
23233828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 27822877 - 27822930
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
27822877 |
cttaattgcacttttggacccctatctttccaaaatttgcggttatggacccct |
27822930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 28596241 - 28596188
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
28596241 |
cttaattgcacttttggatccctatctttctaaaagttgtggttatggacccct |
28596188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 29233816 - 29233763
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
29233816 |
cttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
29233763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 36801399 - 36801452
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||| |||||||||||||| |
|
|
| T |
36801399 |
cttaattgcacttttggacccctatctttccacaagttgcggttatggacccct |
36801452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 37205542 - 37205595
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37205542 |
cttaattgcatttttgaacccctatcttttcaaaagttgcggttatggacccct |
37205595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 39616862 - 39616809
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
39616862 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
39616809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 39626279 - 39626226
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| || |||||||||||||| |
|
|
| T |
39626279 |
cttaattgcacttttggacccctatctttccaaaagctgcggttatggacccct |
39626226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 39635829 - 39635776
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| || |||||||||||||| |
|
|
| T |
39635829 |
cttaattgcacttttggacccctatctttccaaaagctgcggttatggacccct |
39635776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 41574157 - 41574210
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| ||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
41574157 |
cttaattgtacttttggacctctattttttcaaaagttgtggttatggacccct |
41574210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 42642399 - 42642346
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
42642399 |
cttaattgcacttttggacccctatctttccaaaggttgcggttatggacccct |
42642346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 42906374 - 42906427
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
42906374 |
cttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
42906427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 12330076 - 12330128
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
12330076 |
ttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
12330128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 14024195 - 14024247
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
14024195 |
ttaattgcacgtttggacccctatctttacaaaagttgcggttatggacccct |
14024247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 42363882 - 42363830
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
42363882 |
ttaattgcacttttggacccctttctttttaaaagttgcggttatggacccct |
42363830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 352 - 396
Target Start/End: Complemental strand, 42866404 - 42866360
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42866404 |
cttaattgcacttttggacccctatcttttcaaaagttgcggtta |
42866360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 45208979 - 45209031
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
45208979 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
45209031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 20820063 - 20820012
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |||||||||||| |
|
|
| T |
20820063 |
cttaattgcacttttgaacccctatctttccaaaagttgcggttatggaccc |
20820012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 27339854 - 27339803
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
27339854 |
cttaattgcatttttggacccctatctttttaaaagttgcggttatggaccc |
27339803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 30358845 - 30358896
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| |||||||||||| |
|
|
| T |
30358845 |
cttaattgcacttttggacctcgatcttttcaaaagttgcggttatggaccc |
30358896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 350 - 405
Target Start/End: Original strand, 41206162 - 41206217
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||| |||||||| ||||| |
|
|
| T |
41206162 |
gacttaattgcacttttggacccatatctttccaaaagttgcggttatggccccct |
41206217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 41788643 - 41788706
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||||||| |||||||| ||||||||||||| |
|
|
| T |
41788643 |
aaaaaaaagacttaattgcacttttgaactcctatctttttaaaagttgcagttatggacccct |
41788706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 1985566 - 1985624
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||| ||||||||||| |||||||||||| ||||| |||||||||||||| |
|
|
| T |
1985566 |
aaaggcttaattgtacttttggacctctatcttttcaatagttgcggttatggacccct |
1985624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 7013346 - 7013404
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||||||||||| |||| ||||||||| |
|
|
| T |
7013346 |
aaaggcttaattgcacttttagatccctatcttttcaaaagttgcggttttggacccct |
7013404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 7013666 - 7013608
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||||||||||| | |||||||||||||||||| |||||| ||||||| |
|
|
| T |
7013666 |
aaaggcttaattgcacttttggatctctatcttttcaaaagttgcggttatagacccct |
7013608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 341 - 403
Target Start/End: Complemental strand, 8870583 - 8870521
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||| ||| |||||||||| ||||| |||||||||||| ||||||||| |||||||||||| |
|
|
| T |
8870583 |
taaaattaaggcttaattgcatttttgaacccctatctttccaaaagttgcggttatggaccc |
8870521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 398
Target Start/End: Original strand, 35409703 - 35409761
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||| ||||||||| ||||||| |
|
|
| T |
35409703 |
ataaaataaaggtttaattgcacttttggatccctatctttccaaaagttgcggttatg |
35409761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 37277457 - 37277515
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||| |||||||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
37277457 |
aaaggcttaattgtacttttggacccctatttttttaaaagttgcggttatggacccct |
37277515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 39515870 - 39515812
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||| |||||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
39515870 |
aaaggcttaattgtacttttggactcctatctttccaaaagttgcggttatggacccct |
39515812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 40918685 - 40918639
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
40918685 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatg |
40918639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 351 - 405
Target Start/End: Original strand, 42363579 - 42363633
Alignment:
| Q |
351 |
acttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
42363579 |
acttaattgcacttttggacccttatctttccaaaagttgctgttatggacccct |
42363633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 339 - 405
Target Start/End: Complemental strand, 45516244 - 45516178
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| | || |||||||||| |||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
45516244 |
aataaaaaataggcttaattgcatttttggactcctatcttttcaaaagttgcggttatgaacccct |
45516178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 7150844 - 7150897
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7150844 |
cttaattgcatttttgaacccctatcttttcaaaagttgcagttatggacccct |
7150897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 20056413 - 20056466
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| |||||||| || ||||| |||||||||||||| |
|
|
| T |
20056413 |
cttaattgcacttttggacccttatctttttaatagttgcggttatggacccct |
20056466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 30845556 - 30845609
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
30845556 |
cttaattgtacttttggacccctatctttccaaaagttgcggttatggatccct |
30845609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 31190645 - 31190698
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
31190645 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatagacccct |
31190698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 33947046 - 33947099
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
33947046 |
cttaattgtacttttggacccctatctttccaaaagttgagattatggacccct |
33947099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 35735506 - 35735558
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
35735506 |
cttaattgcacttttggaccc-tatctttccaaaagttgcggttatggacccct |
35735558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 351 - 405
Target Start/End: Complemental strand, 41788961 - 41788905
Alignment:
| Q |
351 |
acttaattgcacttttggacccc--tatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
41788961 |
acttaattgcacttttggacccccctatcttttcaaaagttgcggttatggatccct |
41788905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 42525019 - 42524966
Alignment:
| Q |
353 |
ttaattgcacttttggacccc-tatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
42525019 |
ttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
42524966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 353 - 398
Target Start/End: Complemental strand, 42930928 - 42930883
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
42930928 |
ttaattgcactttttgacccctatcttttcaaaagttgcggttatg |
42930883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 45480363 - 45480310
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| || |||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
45480363 |
cttaactgtacttttggacccctatctttccaaaagttgcggttatggacccct |
45480310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 352 - 400
Target Start/End: Original strand, 16531250 - 16531298
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16531250 |
cttaattgtatttttggacccctatcttttcaaaagttgcggttatgga |
16531298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 18530824 - 18530872
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||| |||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18530824 |
aaaaaaaaggcttaattgcacttttgaacccctatcttttcaaaagttg |
18530872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 25250256 - 25250204
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||| |||||| ||||||| |
|
|
| T |
25250256 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatagacccct |
25250204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 352 - 392
Target Start/End: Complemental strand, 26920027 - 26919987
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtg |
392 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26920027 |
cttaattgcacttttggccccctatcttttcaaaagttgtg |
26919987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 29233545 - 29233597
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
29233545 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatgtacccct |
29233597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 39625970 - 39626022
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39625970 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
39626022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 39635520 - 39635572
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39635520 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
39635572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 41574462 - 41574410
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| | |||||||||||| |
|
|
| T |
41574462 |
ttaattgcacttttggacccctatctttctaaaagttgcgattatggacccct |
41574410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 45106745 - 45106693
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
45106745 |
ttaattgcacttttgaacccctatctttttaaaagttgcggttatggatccct |
45106693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 353 - 400
Target Start/End: Original strand, 28595933 - 28595980
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
28595933 |
ttaattgcacttttgaacctctatcttttcaaaagttgcggttatgga |
28595980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 32318817 - 32318766
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
32318817 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatgaaccc |
32318766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 31947856 - 31947894
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31947856 |
cttaattgcacttttggccccctatcttttcaaaagttg |
31947894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 32498380 - 32498418
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32498380 |
cttaattgcacttttggccccctatcttttcaaaagttg |
32498418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 401
Target Start/End: Original strand, 8833944 - 8833993
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| |||||||||| |
|
|
| T |
8833944 |
cttaattgcacttttggacacctatctttcaaaaagttgcggttatggac |
8833993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 18531144 - 18531091
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||| |||||| |
|
|
| T |
18531144 |
cttaattgcacttttggacccctatctttctaaaagttacggttatgaacccct |
18531091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 27872712 - 27872765
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| ||||||||| |||| |
|
|
| T |
27872712 |
cttaattgcacttttggatccctatctttctaaaagttgcggttatggatccct |
27872765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 38593496 - 38593443
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||| ||| ||||||||| |||||| ||||||| |
|
|
| T |
38593496 |
cttaattgcacttttggacctctatatttccaaaagttgcggttattgacccct |
38593443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 40918395 - 40918448
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
40918395 |
cttaatttcacttttggacccctatctttttaaaagttacggttatggccccct |
40918448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 41554609 - 41554662
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
41554609 |
cttaattgcactttcggacctttatcttttcaaaagttgcggttatggccccct |
41554662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 42642094 - 42642147
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||| ||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
42642094 |
cttaattgcacgttttgacccctatctttctaaaagttggggttatggacccct |
42642147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 341 - 390
Target Start/End: Complemental strand, 44807397 - 44807348
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44807397 |
taaattaaaggcttaattgcacttttgaccccctatcttttcaaaagttg |
44807348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 6655279 - 6655331
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||| ||| |||| |||||||| |||||||||||||| |
|
|
| T |
6655279 |
ttaattgcacttttgaacccatatttttttaaaagttgcggttatggacccct |
6655331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 6735681 - 6735733
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||| ||| |||| |||||||| |||||||||||||| |
|
|
| T |
6735681 |
ttaattgcacttttgaacccatatttttttaaaagttgcggttatggacccct |
6735733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 388
Target Start/End: Complemental strand, 7318946 - 7318910
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagt |
388 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7318946 |
cttaattgcacttttggacccctatctttccaaaagt |
7318910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 392
Target Start/End: Original strand, 7658604 - 7658644
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtg |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7658604 |
cttaattgcacttttgaccccctatcttttcaaaagttgtg |
7658644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 15188270 - 15188218
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
15188270 |
ttaattgtacttttggacctctatccttctaaaagttgtggttatggacccct |
15188218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 25910281 - 25910333
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| ||| | ||||||||||||| |||||||||||||| |
|
|
| T |
25910281 |
ttaattgcacttttggagtcctttattttcaaaagttgcggttatggacccct |
25910333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 404
Target Start/End: Complemental strand, 32693025 - 32692973
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||| ||| |||||||| |||| |
|
|
| T |
32693025 |
cttaattgtacttttggacccctatctttccaaaaattgcggttatggccccc |
32692973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 396
Target Start/End: Original strand, 43657494 - 43657538
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
43657494 |
cttaattgcacttttggacccctaactttccaaaagttgcggtta |
43657538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 396
Target Start/End: Complemental strand, 43658492 - 43658448
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
43658492 |
cttaattgcacttttggacccctaactttccaaaagttgcggtta |
43658448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 353 - 396
Target Start/End: Complemental strand, 3345684 - 3345641
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
3345684 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
3345641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 339 - 390
Target Start/End: Complemental strand, 38701983 - 38701933
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||| | || |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38701983 |
aataaaaaataggcttaattgcacttttg-acccctatcttttcaaaagttg |
38701933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 29197301 - 29197338
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29197301 |
cttaattgcacttttg-acccctatcttttcaaaagttg |
29197338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 401
Target Start/End: Original strand, 29454348 - 29454395
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| |||||||||| |
|
|
| T |
29454348 |
cttaattgcacttttggacccc--tctttccaaaagttgcggttatggac |
29454395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 41693363 - 41693317
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||||||||||| || ||||||| ||||||||| ||||||| |
|
|
| T |
41693363 |
cttaattgcacttttggatccttatctttccaaaagttgcggttatg |
41693317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 355 - 396
Target Start/End: Original strand, 3340071 - 3340112
Alignment:
| Q |
355 |
aattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
3340071 |
aattgcacttttggacccctaactttccaaaagttgcggtta |
3340112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 385
Target Start/End: Original strand, 4106871 - 4106904
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaa |
385 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
4106871 |
cttaatttcacttttggacccctatcttttcaaa |
4106904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 7653666 - 7653614
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| |||| || ||||||||| |||||||| ||||| |
|
|
| T |
7653666 |
cttaattgcacttttggacccttatc-ttccaaaagttgcggttatggccccct |
7653614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 349 - 386
Target Start/End: Original strand, 33687680 - 33687717
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaa |
386 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
33687680 |
agacttaattgcacttttggccccctatctttccaaaa |
33687717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 41554898 - 41554845
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |||| ||| ||||| |
|
|
| T |
41554898 |
cttaattgcacttttggatccctatctttctaaaagttgcggttgtggccccct |
41554845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 42524712 - 42524765
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| | |||| ||||||| |
|
|
| T |
42524712 |
cttaattgcacttttggatccctatctttctaaaagttgcgattatagacccct |
42524765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 42866154 - 42866206
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| || | |||||||||||||||||| ||||| |||||||| |
|
|
| T |
42866154 |
cttaattgcacttttagatctctatcttttcaaaagttgcggtta-ggacccct |
42866206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 369 - 405
Target Start/End: Original strand, 3411420 - 3411456
Alignment:
| Q |
369 |
acccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
3411420 |
acccctatctttccaaaagttgcggttatggacccct |
3411456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 345 - 389
Target Start/End: Complemental strand, 9878790 - 9878746
Alignment:
| Q |
345 |
ataaagacttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
|||||| ||||||||||||||||| || |||| |||||||||||| |
|
|
| T |
9878790 |
ataaaggcttaattgcacttttggtcctctattttttcaaaagtt |
9878746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 350 - 390
Target Start/End: Complemental strand, 17075067 - 17075027
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
17075067 |
gacttaattgcacttttgaccccctatctttttaaaagttg |
17075027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 350 - 390
Target Start/End: Original strand, 17573203 - 17573243
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
17573203 |
gacttaattgcacttttgaccccctatctttttaaaagttg |
17573243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 380
Target Start/End: Original strand, 20283810 - 20283846
Alignment:
| Q |
344 |
aataaagacttaattgcacttttggacccctatcttt |
380 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20283810 |
aataaaggtttaattgcacttttggacccctatcttt |
20283846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 380
Target Start/End: Original strand, 21070438 - 21070474
Alignment:
| Q |
344 |
aataaagacttaattgcacttttggacccctatcttt |
380 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21070438 |
aataaaggtttaattgcacttttggacccctatcttt |
21070474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 353 - 389
Target Start/End: Original strand, 32164838 - 32164874
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
32164838 |
ttaattgcacttttggtcccctatctttttaaaagtt |
32164874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 36801675 - 36801626
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
36801675 |
cttaattgcacttttggacccctatct----aaaagttatggttatggatccct |
36801626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 7e-22; HSPs: 197)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 337 - 402
Target Start/End: Original strand, 12640807 - 12640872
Alignment:
| Q |
337 |
ataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12640807 |
ataataatataaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
12640872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 14578751 - 14578698
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14578751 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
14578698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 38371273 - 38371326
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38371273 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
38371326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 337 - 397
Target Start/End: Complemental strand, 37432544 - 37432484
Alignment:
| Q |
337 |
ataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37432544 |
ataataaaattaagacttaattgcacttttggacccctatcttttcaaaagttgcggttat |
37432484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 349 - 405
Target Start/End: Complemental strand, 50513356 - 50513300
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50513356 |
agacttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
50513300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 350 - 405
Target Start/End: Original strand, 41707718 - 41707773
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41707718 |
gacttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
41707773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 11530076 - 11530018
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11530076 |
aaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11530018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 52046032 - 52045974
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52046032 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
52045974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 233002 - 232949
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
233002 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
232949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 6769107 - 6769054
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6769107 |
cttaattacacttttggacccctatcttttcaaaagttgtggttatggacccct |
6769054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 7644459 - 7644512
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7644459 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
7644512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 7666509 - 7666456
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7666509 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
7666456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 8891964 - 8891911
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8891964 |
cttaattgcactttaggacccctatcttttcaaaagttgtggttatggacccct |
8891911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 18988181 - 18988234
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18988181 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
18988234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 23419645 - 23419592
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23419645 |
cttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
23419592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 29548491 - 29548438
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29548491 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
29548438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 31250780 - 31250727
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31250780 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31250727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 34362822 - 34362875
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34362822 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34362875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 45289811 - 45289758
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45289811 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45289758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 333 - 405
Target Start/End: Original strand, 14578421 - 14578493
Alignment:
| Q |
333 |
aaaaataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||| | || ||||||||||||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
14578421 |
aaaaataataaaaaataggcttaattgcacttttggacccctatctttccaaaagttgcggttatgtacccct |
14578493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 47853967 - 47854027
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47853967 |
taaaacaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
47854027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 352 - 404
Target Start/End: Original strand, 48277918 - 48277970
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48277918 |
cttaattgcatttttggacccctatcttttcaaaagttgtggttatggacccc |
48277970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 341 - 405
Target Start/End: Original strand, 55586607 - 55586671
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
55586607 |
taaaagaaaggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
55586671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 352 - 399
Target Start/End: Original strand, 13019275 - 13019322
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13019275 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
13019322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 39136300 - 39136351
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39136300 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
39136351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 11529756 - 11529814
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11529756 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11529814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 27246856 - 27246914
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27246856 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27246914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 41205812 - 41205754
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
41205812 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41205754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 104202 - 104255
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
104202 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
104255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 336 - 405
Target Start/End: Complemental strand, 104527 - 104458
Alignment:
| Q |
336 |
aataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||| |||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
104527 |
aataataaaaataaggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
104458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 5344266 - 5344323
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
5344266 |
taaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatagaccc |
5344323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 11159731 - 11159678
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11159731 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11159678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 17262396 - 17262343
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
17262396 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
17262343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 17554357 - 17554304
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
17554357 |
cttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccct |
17554304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 20466387 - 20466440
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
20466387 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
20466440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 22159831 - 22159884
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
22159831 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
22159884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 23315689 - 23315636
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23315689 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23315636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 24415385 - 24415332
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
24415385 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
24415332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 24542756 - 24542809
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24542756 |
cttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
24542809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 344 - 405
Target Start/End: Original strand, 27751157 - 27751218
Alignment:
| Q |
344 |
aataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| |||||||||||||||||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
27751157 |
aataaaggcttaattgcacttttggacctctatgtttccaaaagttgtggttatggacccct |
27751218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 34363129 - 34363076
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
34363129 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatgggcccct |
34363076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 35364198 - 35364251
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
35364198 |
cttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
35364251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 37289457 - 37289510
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
37289457 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37289510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 37289767 - 37289714
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
37289767 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
37289714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 39946388 - 39946335
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
39946388 |
cttaattgcacttttggacccttatctttccaaaagttgtggttatggacccct |
39946335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 41205500 - 41205553
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
41205500 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41205553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 42672379 - 42672326
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
42672379 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42672326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 44921921 - 44921868
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
44921921 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
44921868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 45289502 - 45289555
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45289502 |
cttaaatgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45289555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 50996037 - 50996090
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50996037 |
cttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
50996090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 51537432 - 51537485
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
51537432 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
51537485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 340 - 401
Target Start/End: Original strand, 51696526 - 51696587
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
51696526 |
ataaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
51696587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 52045723 - 52045776
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
52045723 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52045776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 52310803 - 52310856
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
52310803 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52310856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 52311113 - 52311060
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
52311113 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52311060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 334 - 390
Target Start/End: Original strand, 2016239 - 2016295
Alignment:
| Q |
334 |
aaaataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2016239 |
aaaagaataaaataaaggcttaattgcacttttggccccctatcttttcaaaagttg |
2016295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 333 - 405
Target Start/End: Complemental strand, 7705919 - 7705847
Alignment:
| Q |
333 |
aaaaataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||| ||| |||||||||||||||||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
7705919 |
aaaaacaataaaaataaggcttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
7705847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 352 - 404
Target Start/End: Original strand, 8482861 - 8482913
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
8482861 |
cttaattgcacttttggacccctattttttcaaaagttgcggttatggacccc |
8482913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 27751474 - 27751422
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27751474 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27751422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 401
Target Start/End: Original strand, 31843790 - 31843838
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31843790 |
ttaattacacttttggacccctatcttttcaaaagttgtggttatggac |
31843838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 352 - 404
Target Start/End: Complemental strand, 31844098 - 31844046
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
31844098 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccc |
31844046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 34957667 - 34957615
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
34957667 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
34957615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 6386727 - 6386786
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
6386727 |
taaaggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
6386786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 403
Target Start/End: Original strand, 7705592 - 7705643
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
7705592 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
7705643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 350 - 405
Target Start/End: Original strand, 8891654 - 8891709
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
8891654 |
gacttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8891709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 399
Target Start/End: Complemental strand, 10046247 - 10046200
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10046247 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
10046200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 12641130 - 12641079
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
12641130 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
12641079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 7666197 - 7666255
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
7666197 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
7666255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 353 - 399
Target Start/End: Complemental strand, 19869468 - 19869422
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19869468 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatgg |
19869422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 20474027 - 20473969
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20474027 |
aaaggcttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
20473969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 43822009 - 43821963
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43822009 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatg |
43821963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 1377607 - 1377660
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
1377607 |
cttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
1377660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 4902467 - 4902414
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
4902467 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
4902414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 5344582 - 5344529
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
5344582 |
cttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
5344529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 401
Target Start/End: Complemental strand, 7119905 - 7119856
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
7119905 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
7119856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 13021290 - 13021237
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
13021290 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
13021237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 13607919 - 13607972
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
13607919 |
cttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
13607972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 339 - 404
Target Start/End: Complemental strand, 17221626 - 17221561
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
||||| |||||| |||||||| ||||||||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
17221626 |
aataatataaaggcttaattgtacttttggatccttatcttttcaaaagttgcggttatggacccc |
17221561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 17262092 - 17262145
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
17262092 |
cttaattgcactcttggaccactatcttttcaaaagttgcggttatggacccct |
17262145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 353 - 402
Target Start/End: Original strand, 17554048 - 17554097
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
17554048 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
17554097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 18988491 - 18988438
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| || ||||||||||| |
|
|
| T |
18988491 |
cttaattgcacttttggacccctatctttttaaaagttgcggctatggacccct |
18988438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 19693019 - 19693072
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
19693019 |
cttaattgcacttttggacccctaactttccaaaagttgtggttacggacccct |
19693072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 19703604 - 19703657
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
19703604 |
cttaattgcacttttggacccctaactttccaaaagttgtggttacggacccct |
19703657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 353 - 402
Target Start/End: Original strand, 20472552 - 20472601
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
20472552 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
20472601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 20472857 - 20472804
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20472857 |
cttaattgtacttttggacccctatctttccaaaagttgcggttatggacccct |
20472804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 21536882 - 21536935
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
21536882 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggaaccct |
21536935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 22160139 - 22160086
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22160139 |
cttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
22160086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 23769806 - 23769859
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||| ||||| |
|
|
| T |
23769806 |
cttaattgcacttttggacccctatttttttaaaagttgtggttatggccccct |
23769859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 26171243 - 26171296
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
26171243 |
cttaattgcacttttggacccttatcttttcaaaagttgcagttatggacccct |
26171296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 26171555 - 26171498
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
26171555 |
aagacttaattgcacttttggacctctatcttttcaaaagttacggttatggatccct |
26171498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 26675055 - 26675108
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
26675055 |
cttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
26675108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 27247170 - 27247117
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
27247170 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
27247117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 29432358 - 29432305
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
29432358 |
cttaattgcacttttggatccctatcttttcaaaagttacggttatggacccct |
29432305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 353 - 402
Target Start/End: Complemental strand, 34158783 - 34158734
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
34158783 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacc |
34158734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 35083892 - 35083839
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| | |||||||||||| |
|
|
| T |
35083892 |
cttaattgcacttttggacctctatcttttcaaaagttgcgattatggacccct |
35083839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 35364506 - 35364453
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
35364506 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
35364453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 35835778 - 35835831
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
35835778 |
cttaattgcacttttggacccctatcttttcaaaatttacggttatggacccct |
35835831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 39332321 - 39332374
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
39332321 |
cttaattgcatttttggacccctatcttttcaaaagttgcggttatggccccct |
39332374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 46282762 - 46282815
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
46282762 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggccccct |
46282815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 47854291 - 47854238
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
47854291 |
cttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
47854238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 48278227 - 48278174
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
48278227 |
cttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
48278174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 344 - 405
Target Start/End: Original strand, 50513039 - 50513100
Alignment:
| Q |
344 |
aataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||| |||||||| |||| |
|
|
| T |
50513039 |
aataaaggcttaattgcacttttggactcctatcttttcaaaagttgcagttatggatccct |
50513100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 51696840 - 51696787
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
51696840 |
cttaatagcacttttggacccctatctttccaaaagttgcggttatggacccct |
51696787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 52114445 - 52114392
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
52114445 |
cttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
52114392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 54215958 - 54216011
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
54215958 |
cttaattgcacttttggacccctatctttccgaaagttgcggttatggacccct |
54216011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 54216268 - 54216215
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
54216268 |
cttaattgcacttttgaacctctatcttttcaaaagttgcggttatggacccct |
54216215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 55586928 - 55586875
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
55586928 |
cttaattgcacttttggacccctatctttccgaaagttgcggttatggacccct |
55586875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 405
Target Start/End: Original strand, 7119585 - 7119649
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||| |||||||| ||||||||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
7119585 |
taaattaaaggcttaattgtacttttggatccctatctttccaaaagttgcggttatggacccct |
7119649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 24543053 - 24543001
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
24543053 |
ttaattgcacttttggacccctatcttttcaaaagttgcagttatggatccct |
24543001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 28158899 - 28158951
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
28158899 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggatccct |
28158951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 30998494 - 30998442
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
30998494 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
30998442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 31209528 - 31209476
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
31209528 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
31209476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 337 - 405
Target Start/End: Complemental strand, 54556941 - 54556873
Alignment:
| Q |
337 |
ataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
54556941 |
ataataaaaacaaggcttaattgcacttttggacctctatctttctaaaagttgcggttatggacccct |
54556873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 350 - 398
Target Start/End: Original strand, 56296617 - 56296665
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
56296617 |
gacttaattgcacttttggacccctatctttccaaaagttgcggttatg |
56296665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 358 - 405
Target Start/End: Original strand, 28981921 - 28981968
Alignment:
| Q |
358 |
tgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
28981921 |
tgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
28981968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 39136608 - 39136557
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| | |||||||||||| |
|
|
| T |
39136608 |
cttaattgcacttttggacccctatctttccaaaagtagcggttatggaccc |
39136557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 39332621 - 39332562
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||| || |||||||||||||||| ||||||||||||| |||||||| |||||||| |
|
|
| T |
39332621 |
ataaaatataggcttaattgcacttttgaacccctatctttttaaaagttgcggttatgg |
39332562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 42672060 - 42672115
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
42672060 |
aaaaaaaagacttaattgcacttttggacccctatctttcaaaaagttgcggttat |
42672115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 399
Target Start/End: Original strand, 43821721 - 43821768
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
43821721 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
43821768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 3770471 - 3770425
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
3770471 |
cttaattgcacttttggacctctatcttttcaaaagttgcggttatg |
3770425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 398
Target Start/End: Original strand, 7396143 - 7396189
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
7396143 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatg |
7396189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 21537188 - 21537150
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21537188 |
cttaattgcacttttggacccctatcttttcaaaagttg |
21537150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 353 - 399
Target Start/End: Complemental strand, 23770077 - 23770031
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
23770077 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
23770031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 357 - 403
Target Start/End: Complemental strand, 51537737 - 51537691
Alignment:
| Q |
357 |
ttgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
51537737 |
ttgcacttttggacccctatctttccaaaagttgcggttatggaccc |
51537691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 402
Target Start/End: Original strand, 54556616 - 54556666
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
54556616 |
cttaattgcacttttggacccctatttttccaaaagttgcggttatggacc |
54556666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 4902138 - 4902191
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
4902138 |
cttaattgcacttttggacccctatctttccaaaagttgctgttatggccccct |
4902191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 7644770 - 7644717
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
7644770 |
cttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
7644717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 8483171 - 8483118
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||| |||||| ||||||| |
|
|
| T |
8483171 |
cttaattgcacttttggacctctattttttcaaaagttgcggttatagacccct |
8483118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 24415075 - 24415128
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
24415075 |
cttaattgcacttttggacccctatctttccaaaagttgcagttatggatccct |
24415128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 26675366 - 26675314
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
26675366 |
cttaattgcacttttggaccc-tatctttccaaaagttgcggttatggacccct |
26675314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 28982227 - 28982170
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||| ||| ||||||||||||| |||||||||||||| |
|
|
| T |
28982227 |
aagatttaattgcacttttggacctatattttttcaaaagttgcggttatggacccct |
28982170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 29548182 - 29548235
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| |||||| ||||||| |
|
|
| T |
29548182 |
cttaattgcacttttggacccttatctttccaaaagttgcggttatagacccct |
29548235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 29627918 - 29627865
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
29627918 |
cttagttgcatttttggacccctatctttccaaaagttgcggttatggacccct |
29627865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 31209226 - 31209279
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
31209226 |
cttaattggacttttggacccatatctttccaaaagttgcggttatggacccct |
31209279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 34957380 - 34957432
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||| |||||||||||||| |
|
|
| T |
34957380 |
cttaattgcacttttggatcc-tatcttttcaaaagttgcggttatggacccct |
34957432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 38371575 - 38371522
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
38371575 |
cttaatcgcacttttggacctctatcttttcaaaaattgcggttatggacccct |
38371522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 47821477 - 47821530
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
47821477 |
cttaattgcacttttggacccctatctttcaaaaagttgcggttatggccccct |
47821530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 51537927 - 51537874
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
51537927 |
cttaatttcacttttggacccctatctttccaaaagttgcggttatgaacccct |
51537874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 4107508 - 4107560
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4107508 |
ttaattgcatttttggacccctatcttttcaaaagttacagttatggacccct |
4107560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 6768800 - 6768852
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
6768800 |
ttaattgcacttttggacccttatctttctaaaagttgcggttatggacccct |
6768852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 34158474 - 34158526
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
34158474 |
ttaattgcatttttggacccctatctttccaaaaattgcggttatggacccct |
34158526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 37973516 - 37973568
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
37973516 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatagacccct |
37973568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 349 - 405
Target Start/End: Original strand, 40350835 - 40350891
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||||||||| ||||| ||||||||||||| |||||||||||||| |
|
|
| T |
40350835 |
agacttaactgcacttttggattcctattttttcaaaagttgcggttatggacccct |
40350891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 44921617 - 44921669
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||| ||||||||| |||| |
|
|
| T |
44921617 |
ttaattgcacttttggacccttatctttttaaaagttgcggttatggatccct |
44921669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 389
Target Start/End: Complemental strand, 51843613 - 51843565
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
||||| ||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51843613 |
taaaaaaaaaacttaattgcacttttggccccctatcttttcaaaagtt |
51843565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 56296908 - 56296856
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
56296908 |
ttaattgcatttctggacccctatcttttcaaaagttgcggttatggtcccct |
56296856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 355 - 398
Target Start/End: Complemental strand, 1377895 - 1377852
Alignment:
| Q |
355 |
aattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
1377895 |
aattgcactttaggacccctatcttttcaaaagttgcggttatg |
1377852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 343 - 390
Target Start/End: Complemental strand, 9592451 - 9592404
Alignment:
| Q |
343 |
aaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||| | ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9592451 |
aaataatggcttaattgcacttttggccccctatcttttcaaaagttg |
9592404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 353 - 400
Target Start/End: Original strand, 31250481 - 31250528
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
31250481 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatgga |
31250528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 405
Target Start/End: Complemental strand, 33338351 - 33338288
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||| |||||||| |||| ||| ||||| |
|
|
| T |
33338351 |
aaaattaaggcttaattgcacttttggacccctatctttctaaaagttgcggttctggccccct |
33338288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 350 - 405
Target Start/End: Complemental strand, 40351150 - 40351095
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||| ||| |||| |||||||| |||||| ||||||| |
|
|
| T |
40351150 |
gacttaattgcacttttggacccttatttttttaaaagttgcggttatagacccct |
40351095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 1186999 - 1186961
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1186999 |
cttaattgcacttttggccccctatcttttcaaaagttg |
1186961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 6387044 - 6386990
Alignment:
| Q |
352 |
cttaattgcacttttggacccc-tatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
6387044 |
cttaattgcacttttggaccccctatctttctaaaagttgcggttatggacccct |
6386990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 12892826 - 12892864
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12892826 |
cttaattgcacttttggccccctatcttttcaaaagttg |
12892864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 24886534 - 24886572
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24886534 |
cttaattgcacttttggtcccctatcttttcaaaagttg |
24886572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 29860654 - 29860692
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29860654 |
cttaattgcacttttggccccctatcttttcaaaagttg |
29860692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 36945515 - 36945553
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36945515 |
cttaattgcacttttggccccctatcttttcaaaagttg |
36945553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 10045958 - 10046010
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| |||||||| ||||| |
|
|
| T |
10045958 |
cttaattgcacttttggacccctatc-tttccaaagttgcggttatggccccct |
10046010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 353 - 390
Target Start/End: Complemental strand, 13306963 - 13306926
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13306963 |
ttaattgcacttttggccccctatcttttcaaaagttg |
13306926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 13608232 - 13608179
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||| |||||||||| |||||||| ||||||||| |||| |
|
|
| T |
13608232 |
cttaattacacttttggactcctatctttttaaaagttgcggttatggaaccct |
13608179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 397
Target Start/End: Complemental strand, 17266058 - 17266013
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
17266058 |
cttaattgcacttttggacccctatctttctaaaagttgcggttat |
17266013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 353 - 398
Target Start/End: Original strand, 18994670 - 18994715
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
18994670 |
ttaattgcacttttggacccctatctttcgaaaagttgcggttatg |
18994715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 30998185 - 30998238
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
30998185 |
cttaactgcacttttagacctctatctttccaaaagttgcggttatggacccct |
30998238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 35083582 - 35083635
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| ||| |||||||| | ||||||| |||||||||||||| |
|
|
| T |
35083582 |
cttaattgcacttttgaacctctatctttccgaaagttggggttatggacccct |
35083635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 37973826 - 37973773
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
37973826 |
cttagttgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
37973773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 396
Target Start/End: Original strand, 3065962 - 3066006
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
3065962 |
cttaattgcacttttggacccctaactttccaaaagttgcggtta |
3066006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 392
Target Start/End: Complemental strand, 3556225 - 3556185
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtg |
392 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
3556225 |
cttaattgcatttttggccccctatcttttcaaaagttgtg |
3556185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 4107814 - 4107762
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||| ||||||||| |||| |
|
|
| T |
4107814 |
ttaattgcacttttgaacccttatctttttaaaagttgcggttatggatccct |
4107762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 400
Target Start/End: Original strand, 17265851 - 17265899
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
17265851 |
cttaattgtacttttggacccctatctttctaaaagttgcggttatgga |
17265899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 18961836 - 18961884
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||| |||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
18961836 |
aaaattaagatttaattgtacttttggccccctatcttttcaaaagttg |
18961884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 29432050 - 29432102
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||| |||| || |||||| |
|
|
| T |
29432050 |
ttaattgcacttttggacccctatctttccaaaaattgcggttgtgaacccct |
29432102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 347 - 399
Target Start/End: Complemental strand, 33508262 - 33508210
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||| ||||||||| ||| |||| |
|
|
| T |
33508262 |
aaaggcttaatttcacttttggacccctatctttccaaaagttgcggtaatgg |
33508210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 404
Target Start/End: Original strand, 39946082 - 39946134
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
39946082 |
cttaattgcacttttggaccattatctttctaaaagttgcggttatggacccc |
39946134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 389
Target Start/End: Original strand, 44120759 - 44120795
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44120759 |
ttaattgcacttttggccccctatcttttcaaaagtt |
44120795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 346 - 398
Target Start/End: Complemental strand, 47821640 - 47821588
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||| | ||||||| ||||||| |
|
|
| T |
47821640 |
taaaggcttaattgcacttttagacccctatctttccgaaagttgcggttatg |
47821588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 338 - 390
Target Start/End: Original strand, 49869242 - 49869293
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||| |||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49869242 |
taataaaa-aaaggcttaattgcacttttggctccctatcttttcaaaagttg |
49869293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 337 - 388
Target Start/End: Original strand, 19725646 - 19725697
Alignment:
| Q |
337 |
ataataaaataaagacttaattgcacttttggacccctatcttttcaaaagt |
388 |
Q |
| |
|
|||| |||||| || ||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
19725646 |
ataaaaaaatataggcttaattgcacttttggccccctatctttccaaaagt |
19725697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 352 - 399
Target Start/End: Original strand, 41787051 - 41787098
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||| |||||||| |
|
|
| T |
41787051 |
cttaattgcacttttggacccctatctttcaaaaaattgcggttatgg |
41787098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 344 - 390
Target Start/End: Original strand, 1186652 - 1186698
Alignment:
| Q |
344 |
aataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||| ||||||||||||||||| |||||| ||||| |||||||| |
|
|
| T |
1186652 |
aataaaggcttaattgcacttttggccccctaactttttaaaagttg |
1186698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 12893274 - 12893236
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
12893274 |
cttaattgcacttttggccccctatcttttcaaatgttg |
12893236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 18995114 - 18995068
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||| | |||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
18995114 |
cttaattgtatttttggacccctatctttccaaaagttgcggttatg |
18995068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 26858346 - 26858384
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
26858346 |
cttaattgcacttttggccccctatctttttaaaagttg |
26858384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 36414019 - 36413981
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
36414019 |
cttaattgcacttttggccccctatctttccaaaagttg |
36413981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 44121099 - 44121061
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
44121099 |
cttaattacacttttggccccctatcttttcaaaagttg |
44121061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 44822441 - 44822479
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
44822441 |
cttaattgcacctttggacccctatctttccaaaagttg |
44822479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 44932912 - 44932874
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
44932912 |
cttaattgcatttttggtcccctatcttttcaaaagttg |
44932874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 348 - 390
Target Start/End: Original strand, 50073264 - 50073306
Alignment:
| Q |
348 |
aagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
50073264 |
aagacttaattgcacttttggccccctatcttttttaaagttg |
50073306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 397
Target Start/End: Original strand, 54606900 - 54606934
Alignment:
| Q |
363 |
ttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
54606900 |
ttttggacccctatcttttcaaaagttgcggttat |
54606934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 403
Target Start/End: Complemental strand, 54607180 - 54607138
Alignment:
| Q |
361 |
acttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||| |||| |
|
|
| T |
54607180 |
acttttggatccctatcttttcaaaagttgcggttatgaaccc |
54607138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 3770181 - 3770234
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| | |||||| ||||| |
|
|
| T |
3770181 |
cttaattgcacttttggacccctatctttcttaaagttgcgattatggccccct |
3770234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 368 - 405
Target Start/End: Complemental strand, 20466680 - 20466643
Alignment:
| Q |
368 |
gacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20466680 |
gacccctatctttccaaaagttgcggttatggacccct |
20466643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 349 - 390
Target Start/End: Complemental strand, 29860895 - 29860854
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| ||||||||| |
|
|
| T |
29860895 |
agacttaattgcacttttggccccccatctttccaaaagttg |
29860854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 390
Target Start/End: Complemental strand, 34625279 - 34625242
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
34625279 |
ttaattgcacttttggcctcctatcttttcaaaagttg |
34625242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 389
Target Start/End: Complemental strand, 39907395 - 39907358
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
39907395 |
cttaattgcacttttggtcccctatctttttaaaagtt |
39907358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 389
Target Start/End: Original strand, 40919243 - 40919280
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
40919243 |
cttaattgcacttttggccacctatcttttcaaaagtt |
40919280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 390
Target Start/End: Complemental strand, 47096734 - 47096698
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47096734 |
ttaattgcacttttgg-cccctatcttttcaaaagttg |
47096698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 396
Target Start/End: Complemental strand, 3066838 - 3066794
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
||||||||||||||||||||| || |||| ||||||||| ||||| |
|
|
| T |
3066838 |
cttaattgcacttttggacccataactttccaaaagttgcggtta |
3066794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 7e-22; HSPs: 195)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 43914891 - 43914838
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43914891 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
43914838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 342 - 405
Target Start/End: Complemental strand, 32341813 - 32341750
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32341813 |
aaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
32341750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 342 - 405
Target Start/End: Complemental strand, 52143486 - 52143423
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52143486 |
aaaatgaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52143423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 6491727 - 6491674
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6491727 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
6491674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 11018713 - 11018660
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11018713 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11018660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 13791886 - 13791833
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13791886 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
13791833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 21727926 - 21727873
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21727926 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
21727873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 22204307 - 22204360
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22204307 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22204360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 23341966 - 23342019
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23341966 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23342019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 38622714 - 38622661
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38622714 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
38622661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 45884950 - 45885003
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45884950 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45885003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 52149825 - 52149772
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52149825 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52149772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 6809379 - 6809327
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6809379 |
ttaattgcatttttggacccctatcttttcaaaagttgtggttatggacccct |
6809327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 8770460 - 8770516
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8770460 |
aaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
8770516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 341 - 405
Target Start/End: Complemental strand, 20596185 - 20596121
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20596185 |
taaaatataggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20596121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 345 - 405
Target Start/End: Original strand, 23356688 - 23356748
Alignment:
| Q |
345 |
ataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23356688 |
ataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23356748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 341 - 405
Target Start/End: Original strand, 39427402 - 39427466
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
39427402 |
taaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
39427466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 40355851 - 40355903
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40355851 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40355903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 349 - 405
Target Start/End: Original strand, 45680090 - 45680146
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
45680090 |
agacttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
45680146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 349 - 405
Target Start/End: Original strand, 47113387 - 47113443
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
47113387 |
agacttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47113443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 52149520 - 52149572
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52149520 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52149572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 342 - 405
Target Start/End: Complemental strand, 2372733 - 2372670
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
2372733 |
aaaataaaggcttaattgcaattttggacccctatctttttaaaagttgcggttatggacccct |
2372670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 2383338 - 2383401
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
2383338 |
aaaataaaggcttaattgcaattttggacccctatctttttaaaagttgcggttatggacccct |
2383401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 346 - 405
Target Start/End: Complemental strand, 15161615 - 15161556
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
15161615 |
taaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
15161556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 338 - 405
Target Start/End: Complemental strand, 16491300 - 16491233
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
16491300 |
taataaaataaaggcttaattgcacttttggacctttatcttttcaaaagttgcggttatggatccct |
16491233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 354 - 405
Target Start/End: Complemental strand, 29795003 - 29794952
Alignment:
| Q |
354 |
taattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29795003 |
taattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
29794952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 354 - 405
Target Start/End: Complemental strand, 40356158 - 40356107
Alignment:
| Q |
354 |
taattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40356158 |
taattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
40356107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 49227112 - 49227175
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49227112 |
aaaataaaggtttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
49227175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 11018398 - 11018456
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11018398 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11018456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 12690018 - 12690076
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
12690018 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
12690076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 47113703 - 47113645
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
47113703 |
aaaggcttaattgcacttttggacccctatcttttcaaaatttgcggttatggacccct |
47113645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 14742 - 14795
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14742 |
cttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
14795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 344 - 405
Target Start/End: Complemental strand, 922482 - 922421
Alignment:
| Q |
344 |
aataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
922482 |
aataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
922421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 2371488 - 2371435
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
2371488 |
cttaattgcacttttggacccctatcttttaaaaagttgcggttatggacccct |
2371435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 6183293 - 6183240
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
6183293 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttaaggacccct |
6183240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 6809070 - 6809123
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
6809070 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
6809123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 8028962 - 8029015
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
8028962 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
8029015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 8774300 - 8774353
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
8774300 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
8774353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 9058168 - 9058221
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
9058168 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
9058221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 9517252 - 9517305
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9517252 |
cttaattgctcttttggacccctatcttttcaaaagttgcggttatggacccct |
9517305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 11052208 - 11052155
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11052208 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11052155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 11204509 - 11204562
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11204509 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11204562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 20224387 - 20224334
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20224387 |
cttaattgtacttttggacccctatcttttcaaaagttgcggttatggacccct |
20224334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 23342272 - 23342219
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23342272 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23342219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 26861276 - 26861329
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
26861276 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
26861329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 28503447 - 28503394
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28503447 |
cttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
28503394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 32341497 - 32341550
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
32341497 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
32341550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 37028930 - 37028983
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37028930 |
cttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
37028983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 42406885 - 42406938
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42406885 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
42406938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 42407196 - 42407143
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
42407196 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42407143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 340 - 405
Target Start/End: Original strand, 43914568 - 43914633
Alignment:
| Q |
340 |
ataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
43914568 |
ataaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
43914633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 44846920 - 44846973
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44846920 |
cttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
44846973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 45885260 - 45885207
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
45885260 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
45885207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 7598922 - 7598866
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7598922 |
aaaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
7598866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 405
Target Start/End: Complemental strand, 9053724 - 9053660
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccc-tatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||| ||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
9053724 |
aaaattaaggcttaattgcacttttggaccccctatcttttcaaaagttgcggttatggacccct |
9053660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 9517556 - 9517504
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
9517556 |
ttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
9517504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 11204809 - 11204757
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11204809 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11204757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 354 - 402
Target Start/End: Complemental strand, 23357003 - 23356955
Alignment:
| Q |
354 |
taattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23357003 |
taattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
23356955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 32558215 - 32558267
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
32558215 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
32558267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 349 - 405
Target Start/End: Complemental strand, 34988400 - 34988344
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
34988400 |
agacttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
34988344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 52143168 - 52143220
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
52143168 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52143220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 6491408 - 6491471
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| |||||||||||||||||||| |||||||||||||||||| ||||||| |||||| |
|
|
| T |
6491408 |
aaaaaaaaggcttaattgcacttttggacctctatcttttcaaaagttgcggttatgaacccct |
6491471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 350 - 405
Target Start/End: Original strand, 14460301 - 14460356
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
14460301 |
gacttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
14460356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 25098441 - 25098390
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
25098441 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
25098390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 353 - 403
Target Start/End: Original strand, 22071166 - 22071216
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22071166 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
22071216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 2371179 - 2371232
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
2371179 |
cttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
2371232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 3264002 - 3264055
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
3264002 |
cttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
3264055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 6182984 - 6183037
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
6182984 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
6183037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 7598611 - 7598664
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
7598611 |
cttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
7598664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 11051898 - 11051951
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
11051898 |
cttaattgcacttttggacccctatctttccaaaagttgcggttattgacccct |
11051951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 15161299 - 15161352
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
15161299 |
cttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
15161352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 16490976 - 16491029
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
16490976 |
cttaattgcatttttggacccctatcttttcaaaagttgcggttatgaacccct |
16491029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 401
Target Start/End: Original strand, 20224080 - 20224129
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
20224080 |
cttaattgcacttttggactcctatcttttcaaaagttgcggttatggac |
20224129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 353 - 398
Target Start/End: Original strand, 21727615 - 21727660
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21727615 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatg |
21727660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 397
Target Start/End: Complemental strand, 22075662 - 22075617
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22075662 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttat |
22075617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 401
Target Start/End: Complemental strand, 23793093 - 23793044
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
23793093 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
23793044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 27396837 - 27396784
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
27396837 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
27396784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 29704619 - 29704672
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||| ||||||| |
|
|
| T |
29704619 |
cttaattgcacttttggacctctatcttttcaaaagttgcggttatagacccct |
29704672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 29794695 - 29794748
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
29794695 |
cttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
29794748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 30288178 - 30288231
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||| |||||||||||||| |
|
|
| T |
30288178 |
cttaattgcacttttggacccctatctttccagaagttgcggttatggacccct |
30288231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 356 - 405
Target Start/End: Complemental strand, 36139664 - 36139615
Alignment:
| Q |
356 |
attgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
36139664 |
attgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36139615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 37029239 - 37029186
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
37029239 |
cttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
37029186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 39427724 - 39427671
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
39427724 |
cttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
39427671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 41585596 - 41585543
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
41585596 |
cttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
41585543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 45664451 - 45664398
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
45664451 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
45664398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 46320987 - 46320934
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
46320987 |
cttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
46320934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 47764093 - 47764146
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
47764093 |
cttaattgcacttttggacctctattttttcaaaagttgcggttatggacccct |
47764146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 52233433 - 52233486
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
52233433 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
52233486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 8535826 - 8535774
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
8535826 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8535774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 8601065 - 8601013
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
8601065 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8601013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 37 - 105
Target Start/End: Complemental strand, 10330775 - 10330707
Alignment:
| Q |
37 |
tttatgaggttgacattgactcaggttgtgaccacacttgggttcagtgtgatgcaccatgtataggtt |
105 |
Q |
| |
|
||||||| |||| || ||||||||| |||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10330775 |
tttatgaccttgatatcgactcaggtagtgacctcacttgggttcagtgtgatgcaccatgtaaaggtt |
10330707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 19830421 - 19830369
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
19830421 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
19830369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 352 - 404
Target Start/End: Original strand, 31797066 - 31797118
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||| ||||||||||||| |
|
|
| T |
31797066 |
cttaattgcacttttggacccctatctttccaaaaattgcggttatggacccc |
31797118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 36139369 - 36139421
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
36139369 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
36139421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 352 - 400
Target Start/End: Original strand, 46320678 - 46320726
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
46320678 |
cttaattgcacttttggactcctatcttttcaaaagttgcggttatgga |
46320726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 8770774 - 8770723
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| |||||||||||| |
|
|
| T |
8770774 |
cttaattgcacttttggacccctatttttccaaaagttgcggttatggaccc |
8770723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 399
Target Start/End: Complemental strand, 18590141 - 18590094
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
18590141 |
cttaattgcacttttggatccctatctttttaaaagttgtggttatgg |
18590094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 338 - 405
Target Start/End: Original strand, 23208296 - 23208363
Alignment:
| Q |
338 |
taataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| || || ||||||| |||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
23208296 |
taataaagtataggcttaattatacttttggactcctatcttttcaaaagttgcggttatggacccct |
23208363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 28503127 - 28503190
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| ||||||| ||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
28503127 |
aaaaaaaaggcttaattacacttttagacctctatcttttcaaaagttgcggttatggacccct |
28503190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 403
Target Start/End: Complemental strand, 30295181 - 30295130
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
30295181 |
cttaattgcacttttggacccctatctttctaaaagttgtggttatagaccc |
30295130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 353 - 400
Target Start/End: Original strand, 32037846 - 32037893
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32037846 |
ttaattgcatttttggacccctattttttcaaaagttgtggttatgga |
32037893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 352 - 399
Target Start/End: Complemental strand, 40815177 - 40815130
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
40815177 |
cttaattgcacttttggacctctatcttttcaaaagttgcggttatgg |
40815130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 353 - 403
Target Start/End: Original strand, 9332906 - 9332956
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||| |||||||||||| |
|
|
| T |
9332906 |
ttaattgcacttttggagctctatcttttcaaaagttgcggttatggaccc |
9332956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 353 - 403
Target Start/End: Original strand, 9356679 - 9356729
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||| |||||||||||| |
|
|
| T |
9356679 |
ttaattgcacttttggagctctatcttttcaaaagttgcggttatggaccc |
9356729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 26435001 - 26434955
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
26435001 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatg |
26434955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 398
Target Start/End: Original strand, 27855565 - 27855611
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
27855565 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
27855611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 343 - 405
Target Start/End: Original strand, 34988083 - 34988145
Alignment:
| Q |
343 |
aaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
34988083 |
aaataaaagcttaattatacttttggacccctatcttttcaaaagttgcggttatgaacccct |
34988145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 353 - 399
Target Start/End: Original strand, 36230555 - 36230601
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
36230555 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
36230601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 397
Target Start/End: Original strand, 45012629 - 45012679
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
45012629 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttat |
45012679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 49056125 - 49056179
Alignment:
| Q |
352 |
cttaattgcacttttggacccc-tatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
49056125 |
cttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
49056179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 49056434 - 49056380
Alignment:
| Q |
352 |
cttaattgcacttttggacccc-tatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
49056434 |
cttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
49056380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 397
Target Start/End: Original strand, 3383966 - 3384011
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
3383966 |
cttaattgcacttttggacctctatcttttcaaaagttgcggttat |
3384011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 18589851 - 18589904
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |||||||| ||||| |
|
|
| T |
18589851 |
cttaattgcacttttggacctctatctttccaaaagttgcggttatggtcccct |
18589904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 401
Target Start/End: Complemental strand, 20017688 - 20017639
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| | |||||||| |
|
|
| T |
20017688 |
cttaattgcacttttggacccctatctttccaaaagttgcgtttatggac |
20017639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 20471416 - 20471469
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
20471416 |
cttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20471469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 20471723 - 20471670
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20471723 |
cttaattgcatttttgaacccctatctttccaaaagttgcggttatggacccct |
20471670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 20559814 - 20559867
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20559814 |
cttaattgcatttttgaacccctatctttccaaaagttgcggttatggacccct |
20559867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 20560121 - 20560068
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
20560121 |
cttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20560068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 401
Target Start/End: Complemental strand, 22204617 - 22204568
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |||||||||| |
|
|
| T |
22204617 |
cttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
22204568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 30294872 - 30294925
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
30294872 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggatccct |
30294925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 32038150 - 32038097
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
32038150 |
cttaattgcacttttggatccctatctttctaaaagttgtggttatagacccct |
32038097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 401
Target Start/End: Original strand, 38622405 - 38622454
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
38622405 |
cttaattgcacttttggacccctatcttttcagaagttgcagttatggac |
38622454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 43677105 - 43677158
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
43677105 |
cttaattgcacttttggatccctatctttccaaaagttgcggttatgaacccct |
43677158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 43677412 - 43677360
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
43677412 |
cttaattgcacttttggaccc-tatcttttcaaaagttgcggttatgaacccct |
43677360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 49227427 - 49227374
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| | |||||||||||||| |
|
|
| T |
49227427 |
cttaattgcacttttggacccctaactttccaaaagtcgcggttatggacccct |
49227374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 1480555 - 1480503
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
1480555 |
ttaattgcacttttgtacccctatctttccaaaagttgcggttatggatccct |
1480503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 4243133 - 4243185
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
4243133 |
ttaattgtacttttggacccctatctttctaaaagttgcggttatggacccct |
4243185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 352 - 400
Target Start/End: Complemental strand, 4243438 - 4243390
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
4243438 |
cttaattgcacttttggatccctatctttttaaaagttgcggttatgga |
4243390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 13791579 - 13791631
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| |||||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
13791579 |
ttaattgtacttttggactcctatctttccaaaagttgcggttatggacccct |
13791631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 14460612 - 14460560
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
14460612 |
ttaattgtacttttggacccctatctttctaaaagttgcggttatggacccct |
14460560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 401
Target Start/End: Complemental strand, 20359308 - 20359260
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
20359308 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
20359260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 353 - 401
Target Start/End: Original strand, 20551662 - 20551710
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
20551662 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
20551710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 402
Target Start/End: Complemental strand, 25820874 - 25820814
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||| |||| ||||||||| ||||| ||||| |
|
|
| T |
25820874 |
aaaaaaaaggcttaattgcacttttggacccctaactttccaaaagttgcggttacggacc |
25820814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 357 - 405
Target Start/End: Complemental strand, 45680396 - 45680348
Alignment:
| Q |
357 |
ttgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||| |||||||||||||| |
|
|
| T |
45680396 |
ttgcacttttggatccctattttttcaaaagttgcggttatggacccct |
45680348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 352 - 399
Target Start/End: Complemental strand, 10279988 - 10279941
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| |||||||| |
|
|
| T |
10279988 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgg |
10279941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 350 - 405
Target Start/End: Original strand, 19830114 - 19830169
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||| || ||||||||||| |
|
|
| T |
19830114 |
gacttaattgcacttttggacccttatctttcaaaaagttgcggctatggacccct |
19830169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 352 - 399
Target Start/End: Original strand, 40618732 - 40618779
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
40618732 |
cttaattgcacttttggacccctatatttccaaaagttgcggttatgg |
40618779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 350 - 405
Target Start/End: Complemental strand, 52363492 - 52363437
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
52363492 |
gacttaattgcattttttgacccctatctttccaaaagttgcggttatgaacccct |
52363437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 7764492 - 7764454
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7764492 |
cttaattgcacttttggccccctatcttttcaaaagttg |
7764454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 402
Target Start/End: Original strand, 8535530 - 8535580
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||| ||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
8535530 |
cttaactgcacttttggacccctatttttctaaaagttgtggttatggacc |
8535580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 402
Target Start/End: Original strand, 8600769 - 8600819
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||| ||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
8600769 |
cttaactgcacttttggacccctatttttctaaaagttgtggttatggacc |
8600819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 347 - 401
Target Start/End: Original strand, 12071641 - 12071695
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
12071641 |
aaaggcttaattacacttttggacccctatctttcaaaaagttgcggttatggac |
12071695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 398
Target Start/End: Original strand, 13098033 - 13098079
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
13098033 |
cttaattgcacttttggatccctatcttttaaaaagttgcggttatg |
13098079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 15911674 - 15911712
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15911674 |
cttaattgcacttttggccccctatcttttcaaaagttg |
15911712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 402
Target Start/End: Original strand, 23792782 - 23792832
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||||| ||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
23792782 |
cttaattacacttttggacacctatctttccaaaagttgcggttatggacc |
23792832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 402
Target Start/End: Original strand, 25820112 - 25820162
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||| ||||| ||||| |
|
|
| T |
25820112 |
cttaattgcacttttggacccctaactttccaaaagttgcggttacggacc |
25820162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 349 - 399
Target Start/End: Complemental strand, 30289461 - 30289411
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||| |||||||| |
|
|
| T |
30289461 |
agacttaattgcacttttggacccatatctttccaaaagttacggttatgg |
30289411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 353 - 399
Target Start/End: Original strand, 45664162 - 45664208
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
45664162 |
ttaattgcatttttggacccctatctttttaaaagttgcggttatgg |
45664208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 46351534 - 46351496
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46351534 |
cttaattgcacttttggtcccctatcttttcaaaagttg |
46351496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 350 - 391
Target Start/End: Original strand, 7489509 - 7489550
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttgt |
391 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
7489509 |
gacttaattgcacttttggccccctatctttccaaaagttgt |
7489550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 8029268 - 8029215
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| |||||||| |||| |
|
|
| T |
8029268 |
cttaattgcacttttggatccctatctttccaaaagttgcagttatggatccct |
8029215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 8774608 - 8774555
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| |||||| |||||| |
|
|
| T |
8774608 |
cttaattgcacttttggacccttatctttccaaaagttgcagttatgaacccct |
8774555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 12071956 - 12071903
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| | |||||||| ||||||||| |||||| ||||||| |
|
|
| T |
12071956 |
cttaattgcacttttggatctctatctttccaaaagttgcggttatagacccct |
12071903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 20287769 - 20287822
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| ||||| |||| ||||||||| ||||||| |||||| |
|
|
| T |
20287769 |
cttaattgcacttttggaaccctacctttccaaaagttgcggttatgaacccct |
20287822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 23208617 - 23208564
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||| |||||||||||||||||||| ||||||||| ||||| |||||||| |
|
|
| T |
23208617 |
cttagttgtacttttggacccctatctttccaaaagttgcggttacggacccct |
23208564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 401
Target Start/End: Original strand, 27396530 - 27396579
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
||||||| |||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
27396530 |
cttaatttcacttttggatccctatctttctaaaagttgtggttatggac |
27396579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 30288510 - 30288457
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||| ||||||| |||||| |
|
|
| T |
30288510 |
cttaattgcacttttggatctctatcttttaaaaagttgcggttatgaacccct |
30288457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 40814889 - 40814941
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
40814889 |
cttaattgcacttttgga-ccctatctttccaaaagttgcggttatggccccct |
40814941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 41585287 - 41585340
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||||||| | |||||||||||||||||| ||||||||| |||| |
|
|
| T |
41585287 |
cttaattgcatttttggatctctatcttttcaaaagttgcggttatggatccct |
41585340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 42589422 - 42589475
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||| |||||||| ||||| |
|
|
| T |
42589422 |
cttaattgcacttttggacttctatctttacaaaagttgcggttatggccccct |
42589475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 42589712 - 42589660
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
42589712 |
cttaattacacttttggacccctatcttttc-aaagttgcggttatggccccct |
42589660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 43670625 - 43670572
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||||||||| |||||||| ||||| |
|
|
| T |
43670625 |
cttaattgcacatttggacccctatatttccaaaagttgcggttatggccccct |
43670572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 356 - 401
Target Start/End: Complemental strand, 47764398 - 47764353
Alignment:
| Q |
356 |
attgcacttttggacccctatcttttcaaaagttgtggttatggac |
401 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
47764398 |
attgtacttttgaacccctatcttttcaaaagttgcggttatggac |
47764353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 51272679 - 51272732
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||| ||||||| ||| |||||||||| ||||||| |||||||||||||| |
|
|
| T |
51272679 |
cttaattgtacttttgaacctctatcttttcgaaagttgcggttatggacccct |
51272732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 51272989 - 51272936
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
51272989 |
cttaattgcacttttagacccttatctttcaaaaagttgcggttatggacccct |
51272936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 52233723 - 52233670
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||||||||| |||||||| ||||| |
|
|
| T |
52233723 |
cttaattgcatttttggatccctatattttcaaaagttgcggttatggtcccct |
52233670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 388
Target Start/End: Complemental strand, 15051 - 15015
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagt |
388 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15051 |
cttaattgcatttttggacccctatcttttcaaaagt |
15015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 405
Target Start/End: Complemental strand, 5225674 - 5225610
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||| | ||||||||| || ||| ||||| |
|
|
| T |
5225674 |
taaaataaaggtttaattgcacttttggatccctatctttcctaaagttgtgattttggccccct |
5225610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 26932575 - 26932622
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||| |||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26932575 |
aaaaaaaaggcttaattgcacttttg-acccctatcttttcaaaagttg |
26932622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 347 - 398
Target Start/End: Original strand, 30289165 - 30289217
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccc-tatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
30289165 |
aaaggcttaattgcacttttagaccccctatctttccaaaagttgtggttatg |
30289217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 400
Target Start/End: Complemental strand, 33811736 - 33811688
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
33811736 |
cttaattgcatttttggacccctatctttccaaaagttgcggtgatgga |
33811688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 352 - 400
Target Start/End: Complemental strand, 33871206 - 33871158
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
33871206 |
cttaattgcatttttggacccctatctttccaaaagttgcggtgatgga |
33871158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 389
Target Start/End: Original strand, 46038903 - 46038939
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46038903 |
ttaattgcacttttggccccctatcttttcaaaagtt |
46038939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 346 - 390
Target Start/End: Original strand, 52201362 - 52201405
Alignment:
| Q |
346 |
taaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52201362 |
taaaggcttaattgcacttttgg-cccctatcttttcaaaagttg |
52201405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 347 - 390
Target Start/End: Original strand, 1712367 - 1712410
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1712367 |
aaaggcttaattgcacttttgaccccctatcttttcaaaagttg |
1712410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 339 - 390
Target Start/End: Original strand, 35580727 - 35580778
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||| || ||| ||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
35580727 |
aataacatgaaggcttaattgcacttttggccccctatctttccaaaagttg |
35580778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 6912219 - 6912256
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6912219 |
cttaattgcacttttgg-cccctatcttttcaaaagttg |
6912256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 355 - 405
Target Start/End: Complemental strand, 21697181 - 21697132
Alignment:
| Q |
355 |
aattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
21697181 |
aattgcacttttg-acccctatcttttcaaaagttgtgattttggccccct |
21697132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 21932099 - 21932061
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
21932099 |
cttaattgcactttttgccccctatcttttcaaaagttg |
21932061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 26811455 - 26811493
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26811455 |
cttaattgcacttttgaccccctatcttttcaaaagttg |
26811493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 29153536 - 29153498
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
29153536 |
cttaatttcacttttggtcccctatcttttcaaaagttg |
29153498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 35580980 - 35580942
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
35580980 |
cttaattgcacttttggccccctattttttcaaaagttg |
35580942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 46039193 - 46039155
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
46039193 |
cttaattgcacttttggccccctatctttttaaaagttg |
46039155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 390
Target Start/End: Complemental strand, 6912491 - 6912454
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
6912491 |
ttaattgcacttttggccccctatcttttgaaaagttg |
6912454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 390
Target Start/End: Complemental strand, 13344486 - 13344449
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
13344486 |
ttaattgcacttttggccccctattttttcaaaagttg |
13344449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 390
Target Start/End: Complemental strand, 24183394 - 24183357
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| |
|
|
| T |
24183394 |
ttaattgcacttttggtcctctatcttttcaaaagttg |
24183357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 26063923 - 26063975
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||| || ||| ||||| |
|
|
| T |
26063923 |
cttaattgcacttttgg-cccctatcttttcgaaagttgtgattttggccccct |
26063975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 398
Target Start/End: Original strand, 26434712 - 26434757
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| ||||||| |
|
|
| T |
26434712 |
ttaattgcacttttgaacccctatctttccaaaagttacggttatg |
26434757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 390
Target Start/End: Complemental strand, 26932923 - 26932886
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
26932923 |
ttaattgcacttttggccccctatctttccaaaagttg |
26932886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 388
Target Start/End: Complemental strand, 866455 - 866419
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagt |
388 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
866455 |
cttaattgcacttttggatccctatctttccaaaagt |
866419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 363 - 399
Target Start/End: Complemental strand, 13099341 - 13099305
Alignment:
| Q |
363 |
ttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
13099341 |
ttttggactcctatcttttcaaaagttgcggttatgg |
13099305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 349 - 389
Target Start/End: Original strand, 28731349 - 28731388
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
28731349 |
agacttaattgtacttttgg-cccctatcttttcaaaagtt |
28731388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 350 - 390
Target Start/End: Original strand, 29153194 - 29153234
Alignment:
| Q |
350 |
gacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||| |
|
|
| T |
29153194 |
gacttaattgcacttttggccctctatcttctcaaaagttg |
29153234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 380
Target Start/End: Original strand, 33777168 - 33777196
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttt |
380 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33777168 |
cttaattgcacttttggacccctatcttt |
33777196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 353 - 389
Target Start/End: Original strand, 37696252 - 37696288
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
37696252 |
ttaattgtacttttggccccctatcttttcaaaagtt |
37696288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 51; Significance: 4e-20; HSPs: 2)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 351 - 405
Target Start/End: Original strand, 2645 - 2699
Alignment:
| Q |
351 |
acttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2645 |
acttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
2699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 2956 - 2903
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||| ||| ||| |||||||| |||||||||||||| |
|
|
| T |
2956 |
cttaattgcacttttggacccttatttttctaaaagttggggttatggacccct |
2903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 50; Significance: 2e-19; HSPs: 3)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 79298 - 79245
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
79298 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
79245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 399
Target Start/End: Original strand, 78992 - 79039
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
78992 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatgg |
79039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 12974 - 12916
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
12974 |
aaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatggatccct |
12916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283 (Bit Score: 49; Significance: 6e-19; HSPs: 2)
Name: scaffold0283
Description:
Target: scaffold0283; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 1187 - 1239
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1187 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 1494 - 1442
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
1494 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
1442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: scaffold0594
Description:
Target: scaffold0594; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 5909 - 5851
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
5909 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 5594 - 5647
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
5594 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
5647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 401022 - 400964
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
401022 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
400964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 352 - 400
Target Start/End: Original strand, 400706 - 400754
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatgga |
400 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
400706 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
400754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0922 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0922
Description:
Target: scaffold0922; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 144 - 91
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
144 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
91 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0606 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0606
Description:
Target: scaffold0606; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 6870 - 6923
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
6870 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 7712 - 7773
Alignment:
| Q |
341 |
taaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
7712 |
taaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
7773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 8032 - 7979
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
8032 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 46; Significance: 4e-17; HSPs: 4)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 10939 - 10886
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
10939 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
10886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 16229 - 16176
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
16229 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
16176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 10630 - 10683
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
10630 |
cttaattgcacttttagacccctatctttccaaaagttgcgattatggacccct |
10683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 15920 - 15973
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
15920 |
cttaattgcacttttagacccctatctttccaaaagttgcgattatggacccct |
15973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272 (Bit Score: 46; Significance: 4e-17; HSPs: 4)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 10872 - 10819
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10872 |
cttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
10819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 397
Target Start/End: Original strand, 20870 - 20915
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttat |
397 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
20870 |
cttaattgcacttttggacctctatcttttcaaaagttgcggttat |
20915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 347 - 390
Target Start/End: Original strand, 10556 - 10599
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10556 |
aaaggcttaattgcacttttggacccctatcttttccaaagttg |
10599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 21165 - 21107
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||| ||||||||| ||| |||| ||||| |
|
|
| T |
21165 |
aaaggcttaattgcatttttggacccctatctttccaaaagttgcggtaatggccccct |
21107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 46; Significance: 4e-17; HSPs: 3)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 20597 - 20650
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
20597 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
20650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 12050 - 12102
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
12050 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
12102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 343 - 403
Target Start/End: Complemental strand, 20934 - 20874
Alignment:
| Q |
343 |
aaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggaccc |
403 |
Q |
| |
|
||||| || |||| |||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
20934 |
aaatataggcttatttgcacttttggacccctatctttccaaaagttgcggttatggaccc |
20874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 29652 - 29705
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
29652 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 343 - 405
Target Start/End: Complemental strand, 29971 - 29909
Alignment:
| Q |
343 |
aaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
29971 |
aaatcaaggcttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
29909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 81307 - 81360
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
81307 |
cttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
81360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 81613 - 81560
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
81613 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
81560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 139484 - 139432
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
139484 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
139432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Original strand, 139178 - 139230
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
139178 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
139230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 347 - 405
Target Start/End: Complemental strand, 20942 - 20884
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
20942 |
aaaggcttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
20884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 20624 - 20681
Alignment:
| Q |
352 |
cttaattgcacttttggacccct----atcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
20624 |
cttaattgcacttttggacccctccctatcttttcaaaagttgcggttatggacccct |
20681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0951 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0951
Description:
Target: scaffold0951; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 353 - 402
Target Start/End: Original strand, 3708 - 3757
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacc |
402 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
3708 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
3757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0777 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0777
Description:
Target: scaffold0777; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 181 - 128
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
181 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 9949 - 10002
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
9949 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
10002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 10248 - 10195
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
10248 |
cttaattgcatttttggacccctatctttctaaaagttgcggttatggatccct |
10195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 16065 - 16012
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
16065 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
16012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0213
Description:
Target: scaffold0213; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 21358 - 21305
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
21358 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
21305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 21068 - 21121
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||| ||| | |||||| ||||| |
|
|
| T |
21068 |
cttaattgcacttttggatccctatctttccaaaatttgcgattatggccccct |
21121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 22297 - 22350
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
22297 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
22350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 405
Target Start/End: Complemental strand, 22587 - 22534
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
22587 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
22534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1171 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold1171
Description:
Target: scaffold1171; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 352 - 404
Target Start/End: Original strand, 821 - 873
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccc |
404 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
821 |
cttaattgcacttttggacccctatctttccaaaagttgcgtttatggacccc |
873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 14615 - 14563
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
14615 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
14563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 75385 - 75333
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||| |||| |
|
|
| T |
75385 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatggatccct |
75333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 405
Target Start/End: Original strand, 75102 - 75165
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||| ||||||||| ||||||||||||| |
|
|
| T |
75102 |
aaaaaaaaggcttaattgcacttttggacccctatttttccaaaagttgccgttatggacccct |
75165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 2)
Name: scaffold1067
Description:
Target: scaffold1067; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 347 - 405
Target Start/End: Original strand, 1352 - 1410
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||| ||| |||| ||||| |
|
|
| T |
1352 |
aaaggcttaattgcacttttggatccctatcttttcaaaagttgcggtcatggccccct |
1410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 405
Target Start/End: Complemental strand, 1645 - 1594
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
1645 |
ttaattgcacttttgga-ccctatctttccaaaagttgcggttatggccccct |
1594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 2)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 349 - 399
Target Start/End: Original strand, 4540 - 4590
Alignment:
| Q |
349 |
agacttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| | |||||| |
|
|
| T |
4540 |
agacttaattgcacttttggacccttatcttttcaaaagttgcgtttatgg |
4590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 4832 - 4786
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
4832 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatg |
4786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0592 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0592
Description:
Target: scaffold0592; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 9021 - 8975
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9021 |
cttaattgcatttttggacccctatctttccaaaagttgtggttatg |
8975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 352 - 405
Target Start/End: Original strand, 26265 - 26318
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||| |||||||| ||||| |
|
|
| T |
26265 |
cttaattgcacttttgaactcctatcttttcaaaagttgcggttatggccccct |
26318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 355 - 399
Target Start/End: Complemental strand, 26555 - 26511
Alignment:
| Q |
355 |
aattgcacttttggacccctatcttttcaaaagttgtggttatgg |
399 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||| |||||||| |
|
|
| T |
26555 |
aattgcacttttggacctctatctttccaaaagttgcggttatgg |
26511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 334 - 405
Target Start/End: Original strand, 3767 - 3837
Alignment:
| Q |
334 |
aaaataataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
|||||||||||| ||| | |||||||||||||||| |||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
3767 |
aaaataataaaaataaggcctaattgcacttttgga-ccctatctttccaaaagttgcggttatggaaccct |
3837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 21830 - 21884
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggtta |
396 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
21830 |
aaaaaaaaggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
21884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 339 - 405
Target Start/End: Original strand, 752 - 818
Alignment:
| Q |
339 |
aataaaataaagacttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
405 |
Q |
| |
|
||||||| | || |||||||||| |||| ||||||||||||| ||||||||| ||||| |||||||| |
|
|
| T |
752 |
aataaaacataggcttaattgcatttttagacccctatctttccaaaagttgcggttacggacccct |
818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2010 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold2010
Description:
Target: scaffold2010; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 485 - 533
Alignment:
| Q |
342 |
aaaataaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||| |||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
485 |
aaaaaaaaggcttaattgcacttttgaccccctatcttttcaaaagttg |
533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 347 - 390
Target Start/End: Complemental strand, 122646 - 122603
Alignment:
| Q |
347 |
aaagacttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
122646 |
aaaggcttaattgcacttttggccccctatctttccaaaagttg |
122603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0279 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0279
Description:
Target: scaffold0279; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 7226 - 7188
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
7226 |
cttaattgcacttttggccccatatcttttcaaaagttg |
7188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0236 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0236
Description:
Target: scaffold0236; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 23159 - 23121
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
23159 |
cttaattgcacttttggtcctctatcttttcaaaagttg |
23121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Original strand, 31981 - 32019
Alignment:
| Q |
352 |
cttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
31981 |
cttaattgcacttttggccccctatctttccaaaagttg |
32019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 390
Target Start/End: Complemental strand, 55463 - 55426
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttg |
390 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
55463 |
ttaattgcacttttggttccctatcttttcaaaagttg |
55426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 398
Target Start/End: Original strand, 16522 - 16567
Alignment:
| Q |
353 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
398 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
16522 |
ttaattgctcttttggattcctatcttttcaaaagttgcggttatg |
16567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0097 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0097
Description:
Target: scaffold0097; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 345 - 389
Target Start/End: Complemental strand, 47191 - 47147
Alignment:
| Q |
345 |
ataaagacttaattgcacttttggacccctatcttttcaaaagtt |
389 |
Q |
| |
|
|||||| ||||| ||||||||||| ||||||||||| |||||||| |
|
|
| T |
47191 |
ataaaggcttaactgcacttttggccccctatctttccaaaagtt |
47147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University