View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3028_low_20 (Length: 205)
Name: NF3028_low_20
Description: NF3028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3028_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 12 - 183
Target Start/End: Original strand, 42079259 - 42079430
Alignment:
| Q |
12 |
taggacaaggacaattatgcaggttggatggtcgttctttaaagggaagtttagaacctttaaaaaagtaagttgtgttggcaaacatcacattaaaaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42079259 |
taggacaaggacaattatgcaggttggatggtagttctttaaagggaagtttagaacctttaaaaaagtaagttgtgttggcaaacatggcattaaaaag |
42079358 |
T |
|
| Q |
112 |
cgaacgaattgatatttaagagttgtcttttttggtgggtgatcttgataatgaagtcggaatagttctgat |
183 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42079359 |
cgaacgaattgatatttaagggttgtcttctttggtgggtgatcttgataatgaagtcggaatagttctgat |
42079430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 12 - 184
Target Start/End: Original strand, 42081686 - 42081844
Alignment:
| Q |
12 |
taggacaaggacaattatgcaggttggatggtcgttctttaaagggaagtttagaacctttaaaaaagtaagttgtgttggcaaacatcacattaaaaag |
111 |
Q |
| |
|
||||||| ||||| ||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||| ||||| |||||||| |
|
|
| T |
42081686 |
taggacatggacagttatgtgggttggttggtcgttctttaaagggaagtttaaaacctttaaaaaagtaagctgtgttggaaaacacgacattaaa--- |
42081782 |
T |
|
| Q |
112 |
cgaacgaattgatatttaagagttgtcttttttggtgggtgatcttgataatgaagtcggaatagttctgatg |
184 |
Q |
| |
|
| ||||||| |||||||||||||||| ||||| |||||||||||||||| ||||||||||| |
|
|
| T |
42081783 |
-----------acatttaaggtttgtcttttttggtggatgatcctgataatgaagtcggagtagttctgatg |
42081844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University