View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3028_low_5 (Length: 651)
Name: NF3028_low_5
Description: NF3028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3028_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 56 - 93
Target Start/End: Original strand, 44680335 - 44680372
Alignment:
| Q |
56 |
tccatctctagataccttagcagaaatgttccaagcat |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44680335 |
tccatctctagataccttagcagaaatgttccaagcat |
44680372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 422 - 518
Target Start/End: Complemental strand, 4432034 - 4431939
Alignment:
| Q |
422 |
ttcccttttgttttgtatcttgaacatgtaaaatcaatcggagatctatagataggatccaatcttgctgttttgttctgcagacatgcaagttatt |
518 |
Q |
| |
|
|||||| | |||||||| | ||||||||||||| ||| | |||| |||||||||||||||||||||||||| |||| || ||||||||||||| |
|
|
| T |
4432034 |
ttccctctagttttgtagatggaacatgtaaaatttatcacacatctttagataggatccaatcttgctgtttt-ttctcaagccatgcaagttatt |
4431939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University