View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3029R-Insertion-6 (Length: 341)
Name: NF3029R-Insertion-6
Description: NF3029R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3029R-Insertion-6 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 8 - 341
Target Start/End: Complemental strand, 5221015 - 5220682
Alignment:
| Q |
8 |
atagatattctcaatctacagatgattttgtattaannnnnnnatttaatttggatgatatgaaaggtagaaggtgcagcaaatgaagatggcaggaagc |
107 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5221015 |
atagatattctcaatctaaagatggttttgtattattatttttatttaatttggatgatatgaaaggtagaaggtgcagcaaatgaagatggcaggaagg |
5220916 |
T |
 |
| Q |
108 |
caagcatatgggatacctttgcacatgctggcaatggtactctttcttatttatttgtctcaaatttttgtgaagatcaagtataaaatcatattgnnnn |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5220915 |
caagcatatgggatacctttgcacatgctggcaatggtactctttcttatttatttgtctcaaatttttgtgaagattaagtataaaatcatattgaaaa |
5220816 |
T |
 |
| Q |
208 |
nnngtcatttatcttaaccagataaaactttcatgatgaagtttgggtggagcctaactcaaccctacaaaaccggtttgtagagtgagggtcgatgtct |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5220815 |
aaagtcatttatcttaaccagataaaactttcatgatgaagtttgggtggagcctaactcaaccctacaaaaccggcttgtagagtgagggtcgatgtct |
5220716 |
T |
 |
| Q |
308 |
tctacataaaattttaatttcaagcatgatgtca |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5220715 |
tctacataaaattttaatttcaagcatgatgtca |
5220682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 249 - 298
Target Start/End: Complemental strand, 17912852 - 17912803
Alignment:
| Q |
249 |
tttgggtggagcctaactcaaccctacaaaaccggtttgtagagtgaggg |
298 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17912852 |
tttgggttgggcctaactcaaccctacaaaaccggcttgtagagtgaggg |
17912803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 259 - 295
Target Start/End: Complemental strand, 49824656 - 49824620
Alignment:
| Q |
259 |
gcctaactcaaccctacaaaaccggtttgtagagtga |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49824656 |
gcctaactcaaccctacaaaaccggtttgtagagtga |
49824620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 68 - 146
Target Start/End: Complemental strand, 25329981 - 25329903
Alignment:
| Q |
68 |
tgaaaggtagaaggtgcagcaaatgaagatggcaggaagccaagcatatgggatacctttgcacatgctggcaatggta |
146 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||| ||||||| |
|
|
| T |
25329981 |
tgaaagtttgaaggtgcagcaaatgaagatggcaggaaaccaagcatatgggatacctttgcccatggtggaaatggta |
25329903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 68 - 146
Target Start/End: Complemental strand, 25323815 - 25323737
Alignment:
| Q |
68 |
tgaaaggtagaaggtgcagcaaatgaagatggcaggaagccaagcatatgggatacctttgcacatgctggcaatggta |
146 |
Q |
| |
|
|||||||| || |||||||||||| |||||||||||||||||||||| ||||||||||| | |||||||| ||||||| |
|
|
| T |
25323815 |
tgaaaggttgagggtgcagcaaataaagatggcaggaagccaagcatttgggataccttctcccatgctggaaatggta |
25323737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 77 - 146
Target Start/End: Original strand, 9988879 - 9988948
Alignment:
| Q |
77 |
gaaggtgcagcaaatgaagatggcaggaagccaagcatatgggatacctttgcacatgctggcaatggta |
146 |
Q |
| |
|
||||||||| |||||||||| || ||||| ||||||||||||||||||||||| | || ||| ||||||| |
|
|
| T |
9988879 |
gaaggtgcatcaaatgaagacggtaggaaaccaagcatatgggatacctttgcccgtggtggaaatggta |
9988948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 77 - 146
Target Start/End: Original strand, 14331912 - 14331981
Alignment:
| Q |
77 |
gaaggtgcagcaaatgaagatggcaggaagccaagcatatgggatacctttgcacatgctggcaatggta |
146 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||| ||| ||||||| |
|
|
| T |
14331912 |
gaaggtgcagcaaatgaagatggtaggaaaccaagcatatgggatacctttgcccatggtggaaatggta |
14331981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 249 - 298
Target Start/End: Original strand, 19609178 - 19609227
Alignment:
| Q |
249 |
tttgggtggagcctaactcaaccctacaaaaccggtttgtagagtgaggg |
298 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||| ||||| ||||||| |
|
|
| T |
19609178 |
tttgggttgagcctaactcaaccttacaaaaccggcttgtaaggtgaggg |
19609227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 257 - 289
Target Start/End: Complemental strand, 8397074 - 8397042
Alignment:
| Q |
257 |
gagcctaactcaaccctacaaaaccggtttgta |
289 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
8397074 |
gagcctaactcaaccctacaaaaccggcttgta |
8397042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 281
Target Start/End: Complemental strand, 7252282 - 7252250
Alignment:
| Q |
249 |
tttgggtggagcctaactcaaccctacaaaacc |
281 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
7252282 |
tttgggttgagcctaactcaaccctacaaaacc |
7252250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 289
Target Start/End: Complemental strand, 33456072 - 33456032
Alignment:
| Q |
249 |
tttgggtggagcctaactcaaccctacaaaaccggtttgta |
289 |
Q |
| |
|
||||||| | ||||||||||||| ||||||||||||||||| |
|
|
| T |
33456072 |
tttgggttgggcctaactcaaccttacaaaaccggtttgta |
33456032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University