View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3029_high_14 (Length: 207)
Name: NF3029_high_14
Description: NF3029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3029_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 62 - 179
Target Start/End: Original strand, 13274079 - 13274196
Alignment:
| Q |
62 |
tatttttatgagtgtatcaacatactcttttacattatgaatatttcaaaataatccttgaaattgtaaaaagataatcgagttagttcctcattgcatt |
161 |
Q |
| |
|
||||| || |||||||| ||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
13274079 |
tatttgtaggagtgtattaactcactcttttacattatgaatatttcaaaataatccttaaaattgtaaaaagataatcgagttagttcctcattgtatt |
13274178 |
T |
|
| Q |
162 |
tacgacattacacactta |
179 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
13274179 |
tacgatattacacactta |
13274196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 95 - 132
Target Start/End: Original strand, 7878824 - 7878861
Alignment:
| Q |
95 |
attatgaatatttcaaaataatccttgaaattgtaaaa |
132 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
7878824 |
attatgaatatattaaaataatccttgaaattgtaaaa |
7878861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University