View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3029_low_19 (Length: 227)
Name: NF3029_low_19
Description: NF3029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3029_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 17196447 - 17196414
Alignment:
| Q |
1 |
cctcgtttggccttctctctcttgccggttaggg |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
17196447 |
cctcgtttggccttctctctcttgccggttaggg |
17196414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University