View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3030_high_34 (Length: 274)
Name: NF3030_high_34
Description: NF3030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3030_high_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 263
Target Start/End: Complemental strand, 37727216 - 37726972
Alignment:
| Q |
18 |
ataacttctgcgggtattgaaacacattaactaaataaactaaataagttagaccttctagctgctttcatgatgttcttgttgttgccgttgtttttgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37727216 |
ataacttctgcgggtattgaaacacattaactaaataaactaaataagttagaccttctagctgctttcatgatgttcttgttgttg-cgttgtttttgt |
37727118 |
T |
|
| Q |
118 |
cagtgttttagatttatggcgnnnnnnngtattgcagatccatgtctggtttgtggttctgttacttagcatgcaaatttattcctttttgtctttcatt |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37727117 |
cagtgttttagatttatggcgtttttttgtattgcagatccatgtctggtttgtggttctgttacttagcatgcaaatttattcctttttgtcttccatt |
37727018 |
T |
|
| Q |
218 |
cttttctggannnnnnnncctgaaattggaatccgatgtgtttcat |
263 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37727017 |
cttttctggattttttttcctgaaattggaatccgatgtgtttcat |
37726972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 156 - 227
Target Start/End: Original strand, 34809817 - 34809888
Alignment:
| Q |
156 |
tccatgtctggtttgtggttctgttacttagcatgcaaatttattcctttttgtctttcattcttttctgga |
227 |
Q |
| |
|
|||||| | ||||||||| ||||||| | |||||| |||||||||||||||||| | |||| ||||||||| |
|
|
| T |
34809817 |
tccatgaccggtttgtgggtctgttattgagcatgaaaatttattcctttttgttgtacatttttttctgga |
34809888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University