View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3030_high_39 (Length: 250)

Name: NF3030_high_39
Description: NF3030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3030_high_39
NF3030_high_39
[»] chr1 (3 HSPs)
chr1 (1-244)||(47311310-47311552)
chr1 (191-239)||(47320474-47320522)
chr1 (21-67)||(47316669-47316715)


Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 47311310 - 47311552
Alignment:
1 cagaaaaatgatgaagaataacaggttctttggtgtttttgctctttccttgaattgttgtatgaaatgaatttcatgatgagtactatgcaagttacat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47311310 cagaaaaatgatgaagaataacaggttctttggtgtttttgctctttccttgaattgttgtatgaaatgaatttcatgatgagtactatgcaagttacat 47311409  T
101 cacatgttaacatttccatttcttgtgtcaatttagctgtaaattttttccattgtacgtatacttagaagagtgccatttctttcaactagtagtgtct 200  Q
    ||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47311410 cacatgt-aacatttccatctcttgtgtcaatttagctgcaaattttttccattgtacgtatacttagaagagtgccatttctttcaactagtagtgtct 47311508  T
201 atacagcaagtacatagaattgtatcaattgatattcatctcac 244  Q
    | ||||||||||||||||||||||||||||||||||||| ||||    
47311509 acacagcaagtacatagaattgtatcaattgatattcatatcac 47311552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 191 - 239
Target Start/End: Original strand, 47320474 - 47320522
Alignment:
191 agtagtgtctatacagcaagtacatagaattgtatcaattgatattcat 239  Q
    |||||||| |||||| ||||||| |||||||||||||||||||||||||    
47320474 agtagtgtgtatacaacaagtacgtagaattgtatcaattgatattcat 47320522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 67
Target Start/End: Original strand, 47316669 - 47316715
Alignment:
21 acaggttctttggtgtttttgctctttccttgaattgttgtatgaaa 67  Q
    ||||||||||||||  |||| |||||| |||||||||||||||||||    
47316669 acaggttctttggtcctttttctcttttcttgaattgttgtatgaaa 47316715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University