View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3030_high_44 (Length: 243)
Name: NF3030_high_44
Description: NF3030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3030_high_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 9 - 224
Target Start/End: Original strand, 9051302 - 9051517
Alignment:
| Q |
9 |
ggacatcatcaattggaaatgaagatgaacttgaagagagaccaaaatggctagatagatggatggctacaaaaccgtgggagaatagaggaagggcttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9051302 |
ggacatcatcaattggaaatgaagatgaacttgaagagagaccaaaatggctagatagatggatggctacaaaaccgtgggagaataggggaagggcttc |
9051401 |
T |
 |
| Q |
109 |
aaccgatcaaagagactctattaagactgtggaagtcgacacatctcaaccttattcatatctaggagcaaattacagaagatcacatccaaattatcaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9051402 |
aaccgatcaaagagactctattaagactgtggaagtcgacacatctcaaccttattcatatctaggagcaaattacagaagatcacatccaaattatcaa |
9051501 |
T |
 |
| Q |
209 |
tataatccacatcacc |
224 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
9051502 |
tataatccacatcacc |
9051517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University