View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3030_high_53 (Length: 227)
Name: NF3030_high_53
Description: NF3030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3030_high_53 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 12508485 - 12508264
Alignment:
| Q |
6 |
acatcatggagaagataatcattgtgatgattttctcgcaaagattggttctcatatagagatgataagcttagcgatgacaaacaaaactcatatccac |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12508485 |
acatcctggagaagataatcattgtgatgattttctcgcaaagattggttctcatatagagatgataagcttagcgatgacaaacaaaactcatatccac |
12508386 |
T |
 |
| Q |
106 |
atgtatcacatgtattaatatagggtggatactttaatggatattcacgaataaaataaacaaatatttcaattacatgttacttaatcaattttgacac |
205 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12508385 |
atgtatcacatgtactaatacggggtggatactttaatggatattcacgaataaaataaataaatatttcaattacatgttacttaatcaattttgacgc |
12508286 |
T |
 |
| Q |
206 |
agatttaaaggtacatgtgcct |
227 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
12508285 |
agatttaagggtacatgtgcct |
12508264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 193
Target Start/End: Original strand, 26667784 - 26667838
Alignment:
| Q |
139 |
ttaatggatattcacgaataaaataaacaaatatttcaattacatgttacttaat |
193 |
Q |
| |
|
|||||||||||| ||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26667784 |
ttaatggatattaacggataaaataaattgatatttcaattacatgttacttaat |
26667838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University