View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3030_high_59 (Length: 204)
Name: NF3030_high_59
Description: NF3030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3030_high_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 10 - 189
Target Start/End: Complemental strand, 20223357 - 20223179
Alignment:
| Q |
10 |
gaacctgtggtgaagaatttttggcatagctagttttgccaactcctccagtcatatgaaacactttctctacatccannnnnnncttgggtttcttaag |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| | |
|
|
| T |
20223357 |
gaacctgtagtgaagaatttttggcatagctagttttgccaactcctccagtcatatgaaacactttctctacatccatttttttcttggttttctta-g |
20223259 |
T |
 |
| Q |
110 |
ttagaattggactttctagttctggcttgatgaagaagttgtggtcatgttttaaagcaaatttccatgacgtggccatt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20223258 |
ttagaattggactttctagttctggcttgatgaagaagttgtggtcatgttttaaagcaaatttccatgacgtggccatt |
20223179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 158 - 189
Target Start/End: Complemental strand, 25330221 - 25330190
Alignment:
| Q |
158 |
gttttaaagcaaatttccatgacgtggccatt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25330221 |
gttttaaagcaaatttccatgacgtggccatt |
25330190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University