View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3030_low_14 (Length: 457)
Name: NF3030_low_14
Description: NF3030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3030_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 3e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 11612330 - 11612174
Alignment:
| Q |
1 |
tcaagagggtattctgaattgtgaattgtgattgtgataaagtggttcatattcttcatgaatttgtggtggaagctagtgtgaaagttgaaaaatgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612330 |
tcaagagggtattctgaattgtgaattgtgattgtgataaagtggttcatattcttcatgaatttgtggtggaagctagtgtgaaagttgaaaaatgttc |
11612231 |
T |
|
| Q |
101 |
aacggtttcatatggggaattaaagagagatgatggtgggtgacagaagagcacaga |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612230 |
aacggtttcatatggggaattaaagagagatgatggtgggtgacagaagagcacaga |
11612174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 269 - 424
Target Start/End: Complemental strand, 11612061 - 11611905
Alignment:
| Q |
269 |
catgaatgttgaatagtgttttgctatgctatgtttgttgtgagtgtctgnnnnnnnctctttcttaatatgtgtgtgtgtcagttgcataagtcattat |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612061 |
catgaatgttgaatagtgttttgctatgctatgtttgttgtgagtgtctgtttttttctctttcttaatatgtgtgtgtgtcagttgcataagtcattat |
11611962 |
T |
|
| Q |
369 |
caagattgcataa-nnnnnnnnnatctagggatgagggtccttgtttagtttgaata |
424 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11611961 |
caagattgcataattttttttttatctagggatgagggtccttgtttagtttgaata |
11611905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University