View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3030_low_23 (Length: 355)
Name: NF3030_low_23
Description: NF3030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3030_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 95 - 332
Target Start/End: Original strand, 49180320 - 49180557
Alignment:
| Q |
95 |
gaaaatgctgctagttgctattgaacgcggggaaggattcctgttaaattctttgtttaatgcagtgacttacaaaaatggctatatgccacgtataaga |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180320 |
gaaaatgctgctagttgctattgaacgcggggaaggattcctgttaaattctttgttcaatgcagtgacttacaaaaatggctatatgccacgtataaga |
49180419 |
T |
 |
| Q |
195 |
tgagtttgctgctacagggctggaagtcaggtttgagactgtgtctgtgttttgtttgatcttcctttcgttcactatgcatactattcatggttcctca |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180420 |
tgagtttgctgctacagggctggaagtcaggtttgagactgtgtctgtgttttgtttgatcttcctttcgttcactatgcatactattcatggttcctca |
49180519 |
T |
 |
| Q |
295 |
catgttattatagataaaatgatatgcccaatccttgc |
332 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49180520 |
catgttattacagataaaatgatatgcccaatccttgc |
49180557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 13 - 100
Target Start/End: Original strand, 49180160 - 49180247
Alignment:
| Q |
13 |
taggtcattaaaggtgaaaatcactaaatttgtccttcacctattgcatggttgacaactacataattgttaacttttgtgggaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180160 |
taggtcattaaaggtgaaaatcactaaatttgtccttcacctattgcatggttgacaactacataattgttaacttttgtgggaaaat |
49180247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University