View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3030_low_26 (Length: 324)
Name: NF3030_low_26
Description: NF3030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3030_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 263
Target Start/End: Original strand, 27321046 - 27321297
Alignment:
| Q |
9 |
gagatgaacaaaggatgggaacaatgcaagtgcaacaatgaatgttatggacaaagttgatgctggagaacgttcttcggatcgtttagtttaaattgat |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27321046 |
gagatcaacaaaggatgggaacaatgcaagtgcaacaatgggtgttatgagcaaagttgatgctggagaacgttcttcggatcgtttagtttaaattgat |
27321145 |
T |
|
| Q |
109 |
tgagtattaaaattatatgattgagattgggtgtggatgaaaataagtttactattgaattgtttattttatgtataatgatggagctaatctttgtgtt |
208 |
Q |
| |
|
||||||||||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27321146 |
tgagtattaaatt---atgattgagattgggtgtgggtgaaaataagtttactattgaattgtttattttatgtataatgatggagctaatcttcgtgtt |
27321242 |
T |
|
| Q |
209 |
catagaattaaaattttgattttatttatagttcaagagagcactacagttttat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27321243 |
catagaattaaaattttgattttatttatagttcaagagagcactacagttttat |
27321297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University