View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3030_low_28 (Length: 323)
Name: NF3030_low_28
Description: NF3030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3030_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 9e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 186 - 308
Target Start/End: Complemental strand, 52733410 - 52733288
Alignment:
| Q |
186 |
cagcttacacgtttctttcacttcattttgcagtcttcttctgatctgagcagctgtggggtgcatgcaccaattttctaatttactttacctcagttat |
285 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52733410 |
cagcttgcacgtttctttcacttcattttgcagtcttcttctgatctgagcagctgtggggtgcatgcaccaattttctaatttactttacctcagttat |
52733311 |
T |
|
| Q |
286 |
aaataatagaatgcgagtgattt |
308 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
52733310 |
aaataatagaatgcgagtgattt |
52733288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 52733610 - 52733487
Alignment:
| Q |
1 |
aaagtaaagtggagtcaaacctgaatgaatttcttctatctatacttaatctactttgtgtttggtga-----aactcacacaatgcttttggttcggtg |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
52733610 |
aaagtaaagtggagtcaaacctgaatgaatttcttctatctatact-aatctactttgtgtttggtaaggtaaaactcacacaatgcttttggttcggtg |
52733512 |
T |
|
| Q |
96 |
gtggaatacaatcatcgctcacttc |
120 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52733511 |
gtggaatacaatcatcgctcacttc |
52733487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University